Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33609
Trapped Gene
Ccdc135 (ENSMUSG00000031786)
Vector Insertion
Chr 8: 97592081 - 97594302
Public Clones IST12712A9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212965 (Chr8:97591949..97592080 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAAGGGCTGGATGATGATG Chr8:97592041..97592060 60.03 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212965 (Chr8:97591949..97592080 +)
Downstram Exon
ENSMUSE00000502105 (Chr8:97594303..97594375 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAAGGGCTGGATGATGATG Chr8:97592041..97592060 60.03 50 AAGACGGCATGTCAAAGCTC Chr8:97594345..97594364 60.41 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000447993 Chr8:97579003..97579043 No primer for this exon
upstream ENSMUSE00000212958 Chr8:97579901..97580114 TGGAGAGGGTGACAAAGTCC Chr8:97579994..97580013 60.09 55
upstream ENSMUSE00000212964 Chr8:97580501..97580675 GACAACTTCTCCCGCCAGTA Chr8:97580592..97580611 60.26 55
upstream ENSMUSE00000212959 Chr8:97582295..97582420 CACTGGTTGATCCCCTCAAG Chr8:97582398..97582417 60.5 55
upstream ENSMUSE00000286723 Chr8:97582925..97583119 CTCAAGTGCCAGAAGGGAAA Chr8:97582955..97582974 60.37 50
upstream ENSMUSE00000286699 Chr8:97585613..97585771 CTGACCAGCAAGTTTGAGCA Chr8:97585673..97585692 60.17 50
upstream ENSMUSE00000482951 Chr8:97586077..97586295 GCTTCTTCATCGACCCTCTG Chr8:97586168..97586187 59.95 55
upstream ENSMUSE00000212965 Chr8:97591949..97592080 AGAAGGGCTGGATGATGATG Chr8:97592041..97592060 60.03 50

*** Putative Vector Insertion (Chr 8: 97592081 - 97594302) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000502105 Chr8:97594303..97594375 AAGACGGCATGTCAAAGCTC Chr8:97594345..97594364 60.41 50
downstream ENSMUSE00000212956 Chr8:97595141..97595269 GGCCGTTGTTGTTGAGGTAT Chr8:97595236..97595255 59.86 50
downstream ENSMUSE00000212955 Chr8:97595443..97595571 GATGGCCTGGCTTGAAGTAG Chr8:97595559..97595578 59.84 55
downstream ENSMUSE00000212961 Chr8:97596642..97596862 CTCTGGGTCCAAAATTGACG Chr8:97596815..97596834 60.49 50
downstream ENSMUSE00000212960 Chr8:97598016..97598231 GGATGCGCTCTTCCACTATC Chr8:97598109..97598128 59.8 55
downstream ENSMUSE00000212953 Chr8:97598893..97599003 CTGATGTCGGGACAGCTTTT Chr8:97598985..97599004 60.26 50
downstream ENSMUSE00000212950 Chr8:97599104..97599214 GCCTCCCGATACTCTTTGCT Chr8:97599213..97599232 60.73 55
downstream ENSMUSE00000212962 Chr8:97600150..97600344 GGTTAGCCTTGTCGATGAGC Chr8:97600324..97600343 59.84 55
downstream ENSMUSE00000212954 Chr8:97601573..97601712 CTCCTGGTACCATTGCTGCT Chr8:97601617..97601636 60.28 55
downstream ENSMUSE00000580815 Chr8:97601796..97602040 GGAGGCTATGAGGGATAGGG Chr8:97602012..97602031 59.88 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGAAGACCTGGTGAGTCTG Chr8:97592071..97592091 58.8 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGAAGACCTGGTGAGTCTG Chr8:97592071..97592091 58.8 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031786