Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33629
Trapped Gene
Grm7 (ENSMUSG00000056755)
Vector Insertion
Chr 6: 111309075 - 111445646
Public Clones IST11530H12 (tigm) IST12040D12 (tigm) IST12040E2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000556549 (Chr6:111308139..111309074 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCTGTCAGAACATCCCAAT Chr6:111308346..111308365 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000556549 (Chr6:111308139..111309074 +)
Downstram Exon
ENSMUSE00000556547 (Chr6:111445647..111445893 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCTGTCAGAACATCCCAAT Chr6:111308346..111308365 59.93 50 TGGAGATTGTAAGCGTGGTG Chr6:111445683..111445702 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000443091 Chr6:110595862..110596380 GACACTTATGCGCTCGAACA Chr6:110596195..110596214 60.02 50
upstream ENSMUSE00000418428 Chr6:110864321..110864537 CAGTGATGACCGTCGCTATG Chr6:110864359..110864378 60.29 55
upstream ENSMUSE00000418416 Chr6:111016756..111016897 TTTTTGCCAACGATGAGGAT Chr6:111016873..111016892 60.45 40
upstream ENSMUSE00000418410 Chr6:111030313..111030467 AGCCAAAAGAGCTGACCAAG Chr6:111030328..111030347 59.62 50
upstream ENSMUSE00000418405 Chr6:111157737..111157877 AGAAGACACGGATCGCAAAT Chr6:111157852..111157871 59.7 45
upstream ENSMUSE00000231899 Chr6:111196169..111196369 GACAGGAGCGAATTGGAAAA Chr6:111196169..111196188 60.19 45
upstream ENSMUSE00000413044 Chr6:111203987..111204126 TGCTCCAGGACGATATGACA Chr6:111204027..111204046 60.22 50
upstream ENSMUSE00000556549 Chr6:111308139..111309074 GGCTGTCAGAACATCCCAAT Chr6:111308346..111308365 59.93 50

*** Putative Vector Insertion (Chr 6: 111309075 - 111445646) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000556547 Chr6:111445647..111445893 TGGAGATTGTAAGCGTGGTG Chr6:111445683..111445702 59.72 50
downstream ENSMUSE00000694724 Chr6:111516012..111517224 CAGTGCTGATGCCAATGACT Chr6:111516279..111516298 59.86 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATATGTAATCGCCTTGCAG Chr6:111354119..111354140 58.81 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTAGGCTCGTGACTGGGAAA Chr6:111354119..111354139 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056755