Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33655
Trapped Gene
Thoc5 (ENSMUSG00000034274)
Vector Insertion
Chr 11: 4805759 - 4810629
Public Clones IST14522F5 (tigm) IST11956H3 (tigm) IST13677E8 (tigm) IST14889D1 (tigm)
IST10368G5 (tigm) IST12872A6 (tigm) IST10436F9 (tigm) IST13562H3 (tigm)
IST10368G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000307486 (Chr11:4805644..4805758 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCCTGAAGGAGATTGAGGTGA Chr11:4805688..4805708 59.79 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000307486 (Chr11:4805644..4805758 +)
Downstram Exon
ENSMUSE00000307478 (Chr11:4810630..4810762 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCCTGAAGGAGATTGAGGTGA Chr11:4805688..4805708 59.79 47.62 CTGGTCAAATGGCATGAACA Chr11:4810677..4810696 60.52 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682040 Chr11:4795323..4795381 No primer for this exon
upstream ENSMUSE00000342570 Chr11:4795346..4795381 No primer for this exon
upstream ENSMUSE00000385865 Chr11:4799794..4799909 AAAGTGATCCGGAGTGATGG Chr11:4799847..4799866 59.93 50
upstream ENSMUSE00000711275 Chr11:4799794..4799909 AAAGTGATCCGGAGTGATGG Chr11:4799847..4799866 59.93 50
upstream ENSMUSE00000307519 Chr11:4801155..4801298 GGAGCTACAAAGGCTGATGG Chr11:4801238..4801257 59.84 55
upstream ENSMUSE00000307513 Chr11:4802089..4802202 AACCGATTAGCCCACATCAG Chr11:4802152..4802171 59.96 50
upstream ENSMUSE00000307507 Chr11:4802338..4802435 GCAGAAAGTCGATGCCTACC Chr11:4802343..4802362 59.84 55
upstream ENSMUSE00000307497 Chr11:4804098..4804244 AACATTGGCACGTTTGGACT Chr11:4804203..4804222 60.42 45
upstream ENSMUSE00000307486 Chr11:4805644..4805758 TCCTGAAGGAGATTGAGGTGA Chr11:4805688..4805708 59.79 47.62

*** Putative Vector Insertion (Chr 11: 4805759 - 4810629) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000307478 Chr11:4810630..4810762 CTGGTCAAATGGCATGAACA Chr11:4810677..4810696 60.52 45
downstream ENSMUSE00000656041 Chr11:4811438..4811473 GCTGGGAGGAGGATTTCATA Chr11:4811464..4811483 59.08 50
downstream ENSMUSE00000307469 Chr11:4812784..4812861 TGAAAAGAGCTTTGGCTTCG Chr11:4812843..4812862 60.63 45
downstream ENSMUSE00000307463 Chr11:4814273..4814313 GTCGTCTGCTCCTCTTCAGC Chr11:4814315..4814334 60.29 60
downstream ENSMUSE00000307456 Chr11:4814525..4814624 CAGACAGTGGGTGCCTTTTT Chr11:4814603..4814622 60.15 50
downstream ENSMUSE00000307447 Chr11:4815492..4815600 CGTCACTTTGGCTTTCACTG Chr11:4815568..4815587 59.49 50
downstream ENSMUSE00000307437 Chr11:4818127..4818228 GATCTCCCGGATACAAGCAG Chr11:4818179..4818198 59.65 55
downstream ENSMUSE00000307427 Chr11:4819736..4819832 ACCCAGCTTCTGTACCCACA Chr11:4819805..4819824 60.57 55
downstream ENSMUSE00000307418 Chr11:4820380..4820494 TCTGTGAGTGGTCAGGCATC Chr11:4820410..4820429 59.83 55
downstream ENSMUSE00000307410 Chr11:4821925..4822028 CCACTTTACCAGGCGAGAAA Chr11:4822004..4822023 60.24 50
downstream ENSMUSE00000307400 Chr11:4822142..4822229 AGTCCTGCCTCCACAATGTC Chr11:4822182..4822201 60.12 55
downstream ENSMUSE00000307394 Chr11:4824751..4824866 TTGTCATCGTTGCTGTTGGT Chr11:4824862..4824881 60.16 45
downstream ENSMUSE00000307387 Chr11:4826049..4826239 GTAGACGTCCAGCAGCACAC Chr11:4826162..4826181 59.5 60
downstream ENSMUSE00000406092 Chr11:4828678..4828868 GACAAGTCGAGGGGAGTCAG Chr11:4828760..4828779 59.83 60
downstream ENSMUSE00000682039 Chr11:4828678..4828870 GACAAGTCGAGGGGAGTCAG Chr11:4828760..4828779 59.83 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACACATGTAATCGCCTTG Chr11:4805801..4805821 59.99 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCACAGACCAGCCAGAGTC Chr11:4805779..4805799 60.31 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034274