Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33657
Trapped Gene
Rp2h (ENSMUSG00000060090)
Vector Insertion
Chr X: 19977984 - 19981174
Public Clones IST12738D2 (tigm) IST12444H7 (tigm) IST12738D2 (tigm) IST12742A5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000702686 (ChrX:19977896..19977983 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGCATTGAGAACAAGCAG ChrX:19977922..19977941 58.6 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000702686 (ChrX:19977896..19977983 +)
Downstram Exon
ENSMUSE00000440987 (ChrX:19981175..19981205 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGCATTGAGAACAAGCAG ChrX:19977922..19977941 58.6 50 CTAGCAAGGTCCTGGGTTCC ChrX:19981208..19981227 61.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702688 ChrX:19941607..19941954 ATTGGTTGCCATAGGTCGTC ChrX:19941654..19941673 59.82 50
upstream ENSMUSE00000702680 ChrX:19941685..19941954 AAAGGTGTCTGAGCGAGTGG ChrX:19941812..19941831 60.44 55
upstream ENSMUSE00000441005 ChrX:19941692..19941954 AAAGGTGTCTGAGCGAGTGG ChrX:19941812..19941831 60.44 55
upstream ENSMUSE00000557122 ChrX:19941701..19941954 AAAGGTGTCTGAGCGAGTGG ChrX:19941812..19941831 60.44 55
upstream ENSMUSE00000702677 ChrX:19942166..19942324 GGAAGGTGCTGAATCTCCAA ChrX:19942220..19942239 60.19 50
upstream ENSMUSE00000205775 ChrX:19954007..19954672 AGAAAATGCCGTGGTTCAAG ChrX:19954474..19954493 60.11 45
upstream ENSMUSE00000396064 ChrX:19958831..19958945 GAAAACTGAAGACGCCCAAA ChrX:19958878..19958897 60.23 45
upstream ENSMUSE00000358246 ChrX:19974347..19974432 GGATGTTCAACGGGACAAAG ChrX:19974413..19974432 60.35 50
upstream ENSMUSE00000702684 ChrX:19974521..19974529 No primer for this exon
upstream ENSMUSE00000582156 ChrX:19974778..19977979 TTGGGATGCCTAAGTGGAAG ChrX:19975471..19975490 60.07 50
upstream ENSMUSE00000624677 ChrX:19974778..19977254 TTGGGATGCCTAAGTGGAAG ChrX:19975471..19975490 60.07 50
upstream ENSMUSE00000702687 ChrX:19974778..19974872 GGGATATGAAGCGGATTGTG ChrX:19974853..19974872 60.3 50
upstream ENSMUSE00000702686 ChrX:19977896..19977983 GGAGCATTGAGAACAAGCAG ChrX:19977922..19977941 58.6 50

*** Putative Vector Insertion (Chr X: 19977984 - 19981174) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000440987 ChrX:19981175..19981205 CTAGCAAGGTCCTGGGTTCC ChrX:19981208..19981227 61.01 60
downstream ENSMUSE00000440981 ChrX:19981302..19981370 AGGCCATCCAAACTTTCTGA ChrX:19981340..19981359 59.67 45
downstream ENSMUSE00000656601 ChrX:19982334..19982450 AGTTCAGGGGATCCAATGCT ChrX:19982366..19982385 60.85 50
downstream ENSMUSE00000702689 ChrX:19982573..19982781 TTCCAGCCTTGCTCAAAAGT ChrX:19982691..19982710 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGCTTTCTTAATCGCCTTGC ChrX:19981026..19981047 60 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGTGCGTGACTGGGAAAAC ChrX:19981030..19981050 60.16 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060090