Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33659
Trapped Gene
Cpne4 (ENSMUSG00000032564)
Vector Insertion
Chr 9: 104588936 - 104775008
Public Clones IST14628C4 (tigm) IST10861G3 (tigm) IST11013F5 (tigm) IST14671B8 (tigm)
IST14765F4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000530465 (Chr9:104588755..104588935 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAGGCATTTCCGACAGAGA Chr9:104588852..104588871 59.81 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000530465 (Chr9:104588755..104588935 +)
Downstram Exon
ENSMUSE00000419848 (Chr9:104775009..104775188 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAGGCATTTCCGACAGAGA Chr9:104588852..104588871 59.81 45 ACTTCAAACCGGAGACGTTG Chr9:104775115..104775134 60.15 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634685 Chr9:104449616..104450016 CTGGCCACAGAATTGGTTTT Chr9:104449842..104449861 59.97 45
upstream ENSMUSE00000634684 Chr9:104454520..104454603 AGTGTCCTGTCCCTTTGCAT Chr9:104454524..104454543 59.58 50
upstream ENSMUSE00000634683 Chr9:104455297..104455444 CAGAGCCCTCGTGACCTAAA Chr9:104455346..104455365 60.39 55
upstream ENSMUSE00000634682 Chr9:104456748..104456962 AGCATTGCTTACGCCTGTTT Chr9:104456937..104456956 59.91 45
upstream ENSMUSE00000634678 Chr9:104472106..104472431 TTCCAGAGCGACCAAACTCT Chr9:104472205..104472224 59.99 50
upstream ENSMUSE00000530465 Chr9:104588755..104588935 AAAGGCATTTCCGACAGAGA Chr9:104588852..104588871 59.81 45
upstream ENSMUSE00000710592 Chr9:104588755..104588935 AAAGGCATTTCCGACAGAGA Chr9:104588852..104588871 59.81 45

*** Putative Vector Insertion (Chr 9: 104588936 - 104775008) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000419848 Chr9:104775009..104775188 ACTTCAAACCGGAGACGTTG Chr9:104775115..104775134 60.15 50
downstream ENSMUSE00000634681 Chr9:104775009..104775400 ACTTCAAACCGGAGACGTTG Chr9:104775115..104775134 60.15 50
downstream ENSMUSE00000419836 Chr9:104802548..104802619 TCAGCAAGGACTTGGAGAGC Chr9:104802587..104802606 60.68 55
downstream ENSMUSE00000419823 Chr9:104803774..104803848 ATCATCCAATTTCCGTGCAT Chr9:104803848..104803867 60.16 40
downstream ENSMUSE00000266900 Chr9:104824823..104824906 AAGCTGTTGAGTCGCGTCAT Chr9:104824894..104824913 61.01 50
downstream ENSMUSE00000366923 Chr9:104828080..104828169 TCCAGGCTGGGCTTAAGTTAT Chr9:104828112..104828132 60.1 47.62
downstream ENSMUSE00000365756 Chr9:104891902..104892000 GGAGGTGAACTCTCCGATGA Chr9:104891964..104891983 60.2 55
downstream ENSMUSE00000412911 Chr9:104895458..104895544 GGCTTTGTACTTGGGGTTGA Chr9:104895496..104895515 59.97 50
downstream ENSMUSE00000335902 Chr9:104896158..104896217 GCCCATGATGTAGTCCAAGAA Chr9:104896198..104896218 59.95 47.62
downstream ENSMUSE00000419775 Chr9:104909864..104909997 CCCCATTAGAGGCAGTGAAG Chr9:104909897..104909916 59.69 55
downstream ENSMUSE00000354730 Chr9:104920805..104920859 GTGTATTCCGGGGGTATCCT Chr9:104920861..104920880 59.9 55
downstream ENSMUSE00000220909 Chr9:104922096..104922147 ACACTCCGGGTTGTCTTCAT Chr9:104922146..104922165 59.43 50
downstream ENSMUSE00000220911 Chr9:104924618..104924751 TAGGCTTCCACGACTCCTTG Chr9:104924645..104924664 60.39 55
downstream ENSMUSE00000220906 Chr9:104929033..104929269 ACTGGACGATGTCTCGAAGG Chr9:104929246..104929265 60.26 55
downstream ENSMUSE00000692322 Chr9:104935075..104935266 CTTCCGATGAGCACTTTGGT Chr9:104935180..104935199 60.26 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTTGGAATGGCCCAGTAGA Chr9:104729925..104729945 59.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCACGTGACTGGGAAAACC Chr9:104633983..104634003 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032564