Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33669
Trapped Gene
Ptprd (ENSMUSG00000028399)
Vector Insertion
Chr 4: 77571413 - 77857866
Public Clones IST12348B8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672594 (Chr4:77857494..77857865 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAGTTCTCGGTTGGACTGG Chr4:77857548..77857567 60.15 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672594 (Chr4:77857494..77857865 -)
Downstram Exon
ENSMUSE00000672593 (Chr4:77571414..77571468 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAGTTCTCGGTTGGACTGG Chr4:77857548..77857567 60.15 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672594 Chr4:77857494..77857865 ACAGTTCTCGGTTGGACTGG Chr4:77857548..77857567 60.15 55
upstream ENSMUSE00000672593 Chr4:77571414..77571468 No primer for this exon

*** Putative Vector Insertion (Chr 4: 77571413 - 77857866) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000672592 Chr4:77278215..77278283 GTGCAACTCCTCAAGGTTCC Chr4:77278241..77278260 59.7 55
downstream ENSMUSE00000672591 Chr4:77194314..77194421 AGGCACTGCCACTCAGATTT Chr4:77194346..77194365 59.87 50
downstream ENSMUSE00000672590 Chr4:77016004..77016045 AAGGCACTTTCTGCTGTGGT Chr4:77015990..77016009 59.91 50
downstream ENSMUSE00000672589 Chr4:76981315..76981352 TGAAGTCACCAGACGATCCA Chr4:76981301..76981320 60.25 50
downstream ENSMUSE00000672588 Chr4:76840200..76840247 No primer for this exon
downstream ENSMUSE00000672587 Chr4:76627410..76627443 CAGTTAGTGGACAGGCACCA Chr4:76627398..76627417 59.74 55
downstream ENSMUSE00000672586 Chr4:76411604..76411662 AGAAACAGTTCCTGGCCTCA Chr4:76411608..76411627 59.84 50
downstream ENSMUSE00000672585 Chr4:76240171..76240209 GGGTGCTCACCAGACTTCTC Chr4:76240167..76240186 59.84 60
downstream ENSMUSE00000672617 Chr4:76095547..76095636 No primer for this exon
downstream ENSMUSE00000672616 Chr4:75971084..75971249 GACTGCTCCGCTCAGAAACT Chr4:75971186..75971205 59.75 55
downstream ENSMUSE00000716554 Chr4:75971084..75971252 GACTGCTCCGCTCAGAAACT Chr4:75971186..75971205 59.75 55
downstream ENSMUSE00000718194 Chr4:75971084..75971252 GACTGCTCCGCTCAGAAACT Chr4:75971186..75971205 59.75 55
downstream ENSMUSE00000672614 Chr4:75893846..75893855 No primer for this exon
downstream ENSMUSE00000178802 Chr4:75892657..75892802 CCTGTCTGATCAACCGGAGT Chr4:75892741..75892760 60.11 55
downstream ENSMUSE00000526417 Chr4:75892657..75892802 CCTGTCTGATCAACCGGAGT Chr4:75892741..75892760 60.11 55
downstream ENSMUSE00000178803 Chr4:75889549..75889690 TGATCCAGATCCATCGTCAA Chr4:75889639..75889658 60.01 45
downstream ENSMUSE00000672599 Chr4:75889549..75889690 TGATCCAGATCCATCGTCAA Chr4:75889639..75889658 60.01 45
downstream ENSMUSE00000526366 Chr4:75786418..75786606 ACGACCATTGTTGTTGCTTG Chr4:75786415..75786434 59.62 45
downstream ENSMUSE00000526416 Chr4:75786418..75786606 ACGACCATTGTTGTTGCTTG Chr4:75786415..75786434 59.62 45
downstream ENSMUSE00000526345 Chr4:75786177..75786316 AAACAGAAGCCGCAAAACAC Chr4:75786179..75786198 60.29 45
downstream ENSMUSE00000672584 Chr4:75785286..75786316 TGAAATTGCCTAGGGACAGG Chr4:75785511..75785530 60.07 50
downstream ENSMUSE00000672598 Chr4:75785198..75785206 No primer for this exon
downstream ENSMUSE00000672613 Chr4:75785198..75785206 No primer for this exon
downstream ENSMUSE00000672597 Chr4:75784460..75784477 No primer for this exon
downstream ENSMUSE00000672636 Chr4:75784460..75784486 No primer for this exon
downstream ENSMUSE00000672612 Chr4:75782722..75782825 TATAAATTGGCAGGGGCAGA Chr4:75782701..75782720 60.42 45
downstream ENSMUSE00000329636 Chr4:75782715..75782825 TATAAATTGGCAGGGGCAGA Chr4:75782701..75782720 60.42 45
downstream ENSMUSE00000526414 Chr4:75782715..75782825 TATAAATTGGCAGGGGCAGA Chr4:75782701..75782720 60.42 45
downstream ENSMUSE00000672635 Chr4:75782703..75782825 TATAAATTGGCAGGGGCAGA Chr4:75782701..75782720 60.42 45
downstream ENSMUSE00000672619 Chr4:75782519..75782529 No primer for this exon
downstream ENSMUSE00000672596 Chr4:75781449..75781460 No primer for this exon
downstream ENSMUSE00000672615 Chr4:75781449..75781460 No primer for this exon
downstream ENSMUSE00000672602 Chr4:75779245..75779304 CATATGCGAGGCAAGAATGA Chr4:75779244..75779263 59.79 45
downstream ENSMUSE00000477942 Chr4:75778967..75779236 CGTCGACATAGCAACACAGG Chr4:75778985..75779004 60.32 55
downstream ENSMUSE00000662751 Chr4:75778967..75779786 TATGGGGCAGTCACATCTCA Chr4:75779689..75779708 60.07 50
downstream ENSMUSE00000672595 Chr4:75778967..75779236 CGTCGACATAGCAACACAGG Chr4:75778985..75779004 60.32 55
downstream ENSMUSE00000672601 Chr4:75778967..75779240 CGTCGACATAGCAACACAGG Chr4:75778985..75779004 60.32 55
downstream ENSMUSE00000672618 Chr4:75778967..75779237 CGTCGACATAGCAACACAGG Chr4:75778985..75779004 60.32 55
downstream ENSMUSE00000329623 Chr4:75774389..75774970 TGTAGCGTGTGGTGGCTATC Chr4:75774775..75774794 59.75 55
downstream ENSMUSE00000466242 Chr4:75753187..75753320 GTTTAGTGGCTGCCCTGGTA Chr4:75753279..75753298 60.13 55
downstream ENSMUSE00000672611 Chr4:75748863..75749003 CGTGCAGACAGACGGAAGTA Chr4:75748896..75748915 60.05 55
downstream ENSMUSE00000526413 Chr4:75748859..75749003 CGTGCAGACAGACGGAAGTA Chr4:75748896..75748915 60.05 55
downstream ENSMUSE00000526412 Chr4:75746351..75746656 TTCATCGGTTCGAATCAACA Chr4:75746333..75746352 60.05 40
downstream ENSMUSE00000672610 Chr4:75746351..75746657 TTCATCGGTTCGAATCAACA Chr4:75746333..75746352 60.05 40
downstream ENSMUSE00000526411 Chr4:75745316..75745509 TTTTCGAGGAGGACCACTTG Chr4:75745465..75745484 60.22 50
downstream ENSMUSE00000526365 Chr4:75741424..75741450 No primer for this exon
downstream ENSMUSE00000526410 Chr4:75737326..75737443 GACACTAGCTTGGGCTTGCT Chr4:75737318..75737337 59.64 55
downstream ENSMUSE00000526408 Chr4:75731916..75732503 TAATCACGAGCCTGGGTTTC Chr4:75732455..75732474 60.07 50
downstream ENSMUSE00000329585 Chr4:75731365..75731465 GGAATCTCCCAAGACAGCAG Chr4:75731374..75731393 59.8 55
downstream ENSMUSE00000526369 Chr4:75731365..75731462 GGAATCTCCCAAGACAGCAG Chr4:75731374..75731393 59.8 55
downstream ENSMUSE00000672608 Chr4:75731105..75731116 No primer for this exon
downstream ENSMUSE00000526407 Chr4:75730222..75730481 TGTCACCCTATGCTGCAATC Chr4:75730313..75730332 59.68 50
downstream ENSMUSE00000632193 Chr4:75730222..75730472 AACATCAGGCAGTTGCACAG Chr4:75730220..75730239 59.9 50
downstream ENSMUSE00000526403 Chr4:75717848..75717938 AATTTCCCACGCGACTTCTT Chr4:75717869..75717888 60.99 45
downstream ENSMUSE00000526399 Chr4:75712072..75712281 AACGAATGCTTCTGCGTTTT Chr4:75712220..75712239 59.89 40
downstream ENSMUSE00000526398 Chr4:75705573..75705733 ACAACAGGGTCGGAGTATGG Chr4:75705674..75705693 59.84 55
downstream ENSMUSE00000468289 Chr4:75696231..75696343 TTTCTGGACTCCGACTCTGC Chr4:75696295..75696314 60.53 55
downstream ENSMUSE00000526396 Chr4:75685185..75685282 ATTCCTGGGAAAACTTCAGG Chr4:75685168..75685187 58.09 45
downstream ENSMUSE00000526395 Chr4:75657961..75658084 GGGAGTGATCGTATGCAATG Chr4:75657963..75657982 58.95 50
downstream ENSMUSE00000526394 Chr4:75644405..75644580 TCCCCAAATGTTTCAGGAAG Chr4:75644456..75644475 59.9 45
downstream ENSMUSE00000632181 Chr4:75628529..75628609 GGGCCAATACTGGTCACACT Chr4:75628564..75628583 59.85 55
downstream ENSMUSE00000632180 Chr4:75628495..75628523 No primer for this exon
downstream ENSMUSE00000526393 Chr4:75628490..75628609 GGGCCAATACTGGTCACACT Chr4:75628564..75628583 59.85 55
downstream ENSMUSE00000672606 Chr4:75628315..75628321 No primer for this exon
downstream ENSMUSE00000632179 Chr4:75627929..75628012 GCGGTGAACTGGAATTGTCT Chr4:75627944..75627963 60.12 50
downstream ENSMUSE00000632178 Chr4:75627897..75627926 No primer for this exon
downstream ENSMUSE00000632177 Chr4:75627858..75627892 No primer for this exon
downstream ENSMUSE00000672634 Chr4:75627858..75628012 GCGGTGAACTGGAATTGTCT Chr4:75627944..75627963 60.12 50
downstream ENSMUSE00000526391 Chr4:75603000..75603285 CTCCATTCCGGTGACATTCT Chr4:75602990..75603009 59.93 50
downstream ENSMUSE00000526390 Chr4:75602210..75602388 CCATCAAGGAAACTGGCATT Chr4:75602194..75602213 59.93 45
downstream ENSMUSE00000526389 Chr4:75601120..75601246 TCACAACGATGGTGGAATTG Chr4:75601127..75601146 60.37 45
downstream ENSMUSE00000632176 Chr4:75600001..75600102 CAGCCATGGGATCTACAACA Chr4:75600008..75600027 59.52 50
downstream ENSMUSE00000511788 Chr4:75599977..75600102 CAGCCATGGGATCTACAACA Chr4:75600008..75600027 59.52 50
downstream ENSMUSE00000632175 Chr4:75599977..75599996 No primer for this exon
downstream ENSMUSE00000401740 Chr4:75596555..75596709 TCCAGACTTTGGCACTCCTT Chr4:75596616..75596635 59.84 50
downstream ENSMUSE00000632173 Chr4:75596555..75596707 TCCAGACTTTGGCACTCCTT Chr4:75596616..75596635 59.84 50
downstream ENSMUSE00000526386 Chr4:75592947..75593082 ATGGCTGGTCGTTGTGTTCT Chr4:75592938..75592957 60.58 50
downstream ENSMUSE00000662750 Chr4:75587143..75590930 CAGGGGTTTCTACGTTGCAT Chr4:75590831..75590850 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTGGCCTCCTTGCACTAAC Chr4:77617882..77617902 60.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTAAGTGCGTGACTGGGAAA Chr4:77617802..77617823 59.62 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028399