Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33670
Trapped Gene
A830019P07Rik (ENSMUSG00000055453)
Vector Insertion
Chr 19: 35916853 - 35998038
Public Clones IST14800G4 (tigm) IST14503A7 (tigm) IST12747G11 (tigm) IST15096F10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000441748 (Chr19:35997977..35998037 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTCTTGGCAAGGACAATTC Chr19:35998016..35998035 59.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000441748 (Chr19:35997977..35998037 -)
Downstram Exon
ENSMUSE00000488647 (Chr19:35916854..35916911 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTCTTGGCAAGGACAATTC Chr19:35998016..35998035 59.82 50 CTCATGGAGGCTCAGTTGAA Chr19:35916867..35916886 58.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000441761 Chr19:35998860..35999068 TCCTGTTTGTCCGTTGTCAG Chr19:35998972..35998991 59.72 50
upstream ENSMUSE00000441748 Chr19:35997977..35998037 GCTCTTGGCAAGGACAATTC Chr19:35998016..35998035 59.82 50
upstream ENSMUSE00000488647 Chr19:35916854..35916911 CTTCAACTGAGCCTCCATGA Chr19:35916890..35916909 58.96 50

*** Putative Vector Insertion (Chr 19: 35916853 - 35998038) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000485727 Chr19:35915764..35915819 CATTTGGCTCCAAAATGGTC Chr19:35915778..35915797 60.31 45
downstream ENSMUSE00000691711 Chr19:35909711..35911103 AAGCTGATTGCCCTCTAGCA Chr19:35910197..35910216 60.12 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCAAAGGCGTGGCATAATC Chr19:35964982..35965002 59.93 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTATTCCGTGACTGGGAAA Chr19:35964974..35964994 58.07 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055453