Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33671
Trapped Gene
Ntrk2 (ENSMUSG00000055254)
Vector Insertion
Chr 13: 59161824 - 59227793
Public Clones IST12747G11 (tigm) IST14800G4 (tigm) IST15096F10 (tigm) IST13565A10 (tigm)
IST14503A7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 85% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000452359 (Chr13:59161589..59161823 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAATCGCAGCAGGTATGGTC Chr13:59161675..59161694 60.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000452359 (Chr13:59161589..59161823 +)
Downstram Exon
ENSMUSE00000614570 (Chr13:59227794..59227952 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAATCGCAGCAGGTATGGTC Chr13:59161675..59161694 60.1 50 TGCTTGCCGTAGGTGAAGAT Chr13:59227927..59227946 60.8 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000453182 Chr13:58909261..58909374 ACTGTCCTGCTACCGCAGTT Chr13:58909346..58909365 59.94 55
upstream ENSMUSE00000482157 Chr13:58909746..58910301 CGAGGTTGGAACCTAACAGC Chr13:58910256..58910275 59.73 55
upstream ENSMUSE00000453197 Chr13:58939157..58939231 CTTACGTGGGGCTGAGAAAC Chr13:58939210..58939229 59.73 55
upstream ENSMUSE00000453177 Chr13:58939346..58939417 TTCCGGCTTAAAGTTTGTGG Chr13:58939358..58939377 60.1 45
upstream ENSMUSE00000453172 Chr13:58944237..58944305 CAAGCTGACGAGTTTGTCCA Chr13:58944252..58944271 60.03 50
upstream ENSMUSE00000453169 Chr13:58948061..58948215 CGAACCTGCAGATACCCAAT Chr13:58948192..58948211 59.96 50
upstream ENSMUSE00000452404 Chr13:58960530..58960666 ACCTTGTACTGGGACGTTGG Chr13:58960625..58960644 59.88 55
upstream ENSMUSE00000452401 Chr13:58961507..58961639 TTGTGTGGCAGAAAACCTTG Chr13:58961581..58961600 59.73 45
upstream ENSMUSE00000452398 Chr13:58962611..58962916 ATGGCCAAGAACGAGTATGG Chr13:58962841..58962860 59.96 50
upstream ENSMUSE00000452394 Chr13:58973097..58973132 CCCAAATTACCCTGAAGTCC Chr13:58973104..58973123 58.36 50
upstream ENSMUSE00000681770 Chr13:58973097..58973131 CCCAAATTACCCTGAAGTCC Chr13:58973104..58973123 58.36 50
upstream ENSMUSE00000681768 Chr13:58975688..58975786 GCCAACTGACATTGGGGATA Chr13:58975699..58975718 60.72 50
upstream ENSMUSE00000452388 Chr13:58975689..58975786 GCCAACTGACATTGGGGATA Chr13:58975699..58975718 60.72 50
upstream ENSMUSE00000452382 Chr13:58979524..58979623 AGTTGGCGAGACATTCCAAG Chr13:58979591..58979610 60.26 50
upstream ENSMUSE00000681760 Chr13:59033384..59033421 AAGATCCCACTGGATGGGTA Chr13:59033401..59033420 59.21 50
upstream ENSMUSE00000452376 Chr13:59087163..59087351 GTCCCGACGCTGTCATTATT Chr13:59087256..59087275 59.96 50
upstream ENSMUSE00000452370 Chr13:59139328..59139458 TTTTCCTTGCCGAGTGCTAC Chr13:59139397..59139416 60.39 50
upstream ENSMUSE00000183030 Chr13:59155654..59155826 GGGGACCTCAACAAGTTCCT Chr13:59155804..59155823 60.35 55
upstream ENSMUSE00000452359 Chr13:59161589..59161823 AAATCGCAGCAGGTATGGTC Chr13:59161675..59161694 60.1 50

*** Putative Vector Insertion (Chr 13: 59161824 - 59227793) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000614570 Chr13:59227794..59227952 TGCTTGCCGTAGGTGAAGAT Chr13:59227927..59227946 60.8 50
downstream ENSMUSE00000453213 Chr13:59229529..59235331 AAAGAAGTGAAGGGCTGCAA Chr13:59234305..59234324 59.99 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATGGCAGACTTAGGGAAGG Chr13:59191781..59191801 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATGGCAGACTTAGGGAAGG Chr13:59191781..59191801 59.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055254