Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33681
Trapped Gene
Itga11 (ENSMUSG00000032243)
Vector Insertion
Chr 9: 62622192 - 62624419
Public Clones IST14424H4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 89% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000218060 (Chr9:62622105..62622191 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTAACATCTGGGGGAACAGC Chr9:62622118..62622137 59.41 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000218060 (Chr9:62622105..62622191 +)
Downstram Exon
ENSMUSE00000329157 (Chr9:62624420..62624530 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTAACATCTGGGGGAACAGC Chr9:62622118..62622137 59.41 55 CTCAGGTTGCAGATGATGGA Chr9:62624466..62624485 59.79 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636261 Chr9:62525668..62525803 No primer for this exon
upstream ENSMUSE00000329689 Chr9:62544691..62544802 GCTGCCTTCTTTGGCTACAC Chr9:62544750..62544769 60.02 55
upstream ENSMUSE00000422388 Chr9:62575413..62575513 AACTGCACCAAGCTCAACCT Chr9:62575492..62575511 59.91 50
upstream ENSMUSE00000218076 Chr9:62578518..62578609 GCAGGGTCACTCTGTCCAAT Chr9:62578518..62578537 60.12 55
upstream ENSMUSE00000218082 Chr9:62579889..62580003 CTCACGGGTCAACTCCAACT Chr9:62579948..62579967 60.15 55
upstream ENSMUSE00000218080 Chr9:62583076..62583203 GGAGGTCCAACACTTCCTCA Chr9:62583140..62583159 60.09 55
upstream ENSMUSE00000329584 Chr9:62585176..62585324 AAGATGCCGTCCATGAGTTC Chr9:62585198..62585217 60.08 50
upstream ENSMUSE00000218064 Chr9:62591733..62591877 ACGTGACCAGATACGCTGTG Chr9:62591855..62591874 59.78 55
upstream ENSMUSE00000515525 Chr9:62592289..62592454 AGGGGGATCAATCCAGAGAC Chr9:62592310..62592329 60.28 55
upstream ENSMUSE00000514636 Chr9:62593713..62593783 ATGTCGCAGACTGGCTTTTC Chr9:62593748..62593767 60.41 50
upstream ENSMUSE00000218084 Chr9:62599312..62599456 TGATTCCTCACCGAGAGTCC Chr9:62599388..62599407 60.2 55
upstream ENSMUSE00000218068 Chr9:62600051..62600199 CAACCATACTGGCAAGGTCA Chr9:62600118..62600137 59.57 50
upstream ENSMUSE00000218072 Chr9:62602979..62603119 AGAGCGAGGCAAGGTGTATG Chr9:62603083..62603102 60.42 55
upstream ENSMUSE00000218061 Chr9:62603377..62603580 GGATTCCCACAGCTACCAGA Chr9:62603406..62603425 60.07 55
upstream ENSMUSE00000329452 Chr9:62605412..62605542 CTCAATGAGGATGGGCTTGT Chr9:62605481..62605500 60.07 50
upstream ENSMUSE00000329438 Chr9:62608095..62608261 AGCCTCCACTTTGAGCCTTC Chr9:62608123..62608142 60.9 55
upstream ENSMUSE00000329424 Chr9:62609338..62609480 GCCAGGAACACTGTCAAAGG Chr9:62609443..62609462 60.69 55
upstream ENSMUSE00000329406 Chr9:62610614..62610724 CCTAGAGGACCCTGACAACG Chr9:62610661..62610680 59.72 60
upstream ENSMUSE00000218079 Chr9:62613567..62613652 TGTACTGGATGCTCGGAGTG Chr9:62613617..62613636 59.85 55
upstream ENSMUSE00000218073 Chr9:62615403..62615610 CGTCCTCAACATCTCCCAGT Chr9:62615556..62615575 60.11 55
upstream ENSMUSE00000329268 Chr9:62616334..62616432 GCATCGAGTGTGTGAACGAG Chr9:62616350..62616369 60.47 55
upstream ENSMUSE00000329248 Chr9:62617054..62617130 TTCCGTCTGGATTTCGAGTT Chr9:62617060..62617079 59.67 45
upstream ENSMUSE00000218071 Chr9:62619152..62619241 AGTCACGAGCAAGACAGCAC Chr9:62619156..62619175 59.21 55
upstream ENSMUSE00000218062 Chr9:62620767..62620857 GGACCTCCGTTCAACTGTGT Chr9:62620831..62620850 60.01 55
upstream ENSMUSE00000218077 Chr9:62621884..62621997 CCTGCTGATGTTGAGGGACT Chr9:62621964..62621983 60.26 55
upstream ENSMUSE00000218060 Chr9:62622105..62622191 GTAACATCTGGGGGAACAGC Chr9:62622118..62622137 59.41 55

*** Putative Vector Insertion (Chr 9: 62622192 - 62624419) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000329157 Chr9:62624420..62624530 CTCAGGTTGCAGATGATGGA Chr9:62624466..62624485 59.79 50
downstream ENSMUSE00000329125 Chr9:62624661..62624756 TTCCTCTCGGAAGATGAAGG Chr9:62624744..62624763 59.36 50
downstream ENSMUSE00000218081 Chr9:62629743..62629856 GCCAGTCTTCTTGCTTGGAG Chr9:62629779..62629798 60.13 55
downstream ENSMUSE00000413826 Chr9:62630435..62631755 GTACCGCATAGGGGAACAGA Chr9:62631709..62631728 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCAAGGGATGTGGTTAGA Chr9:62622213..62622233 59.55 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCAAGGGATGTGGTTAGA Chr9:62622213..62622233 59.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032243