Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33695
Trapped Gene
Lphn1 (ENSMUSG00000013033)
Vector Insertion
Chr 8: 86424824 - 86439305
Public Clones IST14564E1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000635748 (Chr8:86424614..86424823 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000635748 (Chr8:86424614..86424823 +)
Downstram Exon
ENSMUSE00000714558 (Chr8:86439306..86439467 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000635748 Chr8:86424614..86424823 No primer for this exon

*** Putative Vector Insertion (Chr 8: 86424824 - 86439305) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000710653 Chr8:86439306..86439467 No primer for this exon
downstream ENSMUSE00000714558 Chr8:86439306..86439467 No primer for this exon
downstream ENSMUSE00000581478 Chr8:86442719..86442932 No primer for this exon
downstream ENSMUSE00000706421 Chr8:86442719..86442932 No primer for this exon
downstream ENSMUSE00000635744 Chr8:86446898..86447007 No primer for this exon
downstream ENSMUSE00000706420 Chr8:86446898..86447007 No primer for this exon
downstream ENSMUSE00000635740 Chr8:86450161..86450175 No primer for this exon
downstream ENSMUSE00000706419 Chr8:86450161..86450175 No primer for this exon
downstream ENSMUSE00000635738 Chr8:86453363..86454163 No primer for this exon
downstream ENSMUSE00000706418 Chr8:86453363..86454163 No primer for this exon
downstream ENSMUSE00000272560 Chr8:86454861..86455175 No primer for this exon
downstream ENSMUSE00000273323 Chr8:86455512..86455615 No primer for this exon
downstream ENSMUSE00000273309 Chr8:86455867..86456052 No primer for this exon
downstream ENSMUSE00000273292 Chr8:86456271..86456309 No primer for this exon
downstream ENSMUSE00000273273 Chr8:86456407..86456590 No primer for this exon
downstream ENSMUSE00000273254 Chr8:86456739..86456861 No primer for this exon
downstream ENSMUSE00000212144 Chr8:86457325..86457539 No primer for this exon
downstream ENSMUSE00000212153 Chr8:86457776..86457946 No primer for this exon
downstream ENSMUSE00000212143 Chr8:86458326..86458535 No primer for this exon
downstream ENSMUSE00000212155 Chr8:86458617..86458837 No primer for this exon
downstream ENSMUSE00000212150 Chr8:86458963..86459029 No primer for this exon
downstream ENSMUSE00000212152 Chr8:86459441..86459532 No primer for this exon
downstream ENSMUSE00000272789 Chr8:86459919..86460087 No primer for this exon
downstream ENSMUSE00000273057 Chr8:86461096..86461224 No primer for this exon
downstream ENSMUSE00000470863 Chr8:86461360..86461456 No primer for this exon
downstream ENSMUSE00000212149 Chr8:86461548..86461676 No primer for this exon
downstream ENSMUSE00000635732 Chr8:86461815..86461832 No primer for this exon
downstream ENSMUSE00000343293 Chr8:86462249..86462985 No primer for this exon
downstream ENSMUSE00000581470 Chr8:86463602..86463872 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACACTTTGCCACTCAATG Chr8:86427839..86427859 60.15 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACACTTTGCCACTCAATG Chr8:86427839..86427859 60.15 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013033