Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3370
Trapped Gene
Zfp442 (ENSMUSG00000068130)
Vector Insertion
Chr 2: 150237074 - 150277137
Public Clones XS0248 (sanger) XR0170 (sanger) AF0722 (sanger) (ggtc)
IST13097D3 (tigm) IST13097D3 (tigm) IST13331F4 (tigm)
Private Clones OST166317 (lexicon) OST65655 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682098 (Chr2:150277138..150277222 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTTCTTGGCGTGTTCTGTG Chr2:150277172..150277191 60.03 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682098 (Chr2:150277138..150277222 -)
Downstram Exon
ENSMUSE00000556832 (Chr2:150236947..150237073 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTTCTTGGCGTGTTCTGTG Chr2:150277172..150277191 60.03 50 AGCCCACTCTTCCTGAGTGA Chr2:150236998..150237017 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682098 Chr2:150277138..150277222 TCTTCTTGGCGTGTTCTGTG Chr2:150277172..150277191 60.03 50

*** Putative Vector Insertion (Chr 2: 150237074 - 150277137) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000556832 Chr2:150236947..150237073 AGCCCACTCTTCCTGAGTGA Chr2:150236998..150237017 59.99 55
downstream ENSMUSE00000556831 Chr2:150236677..150236737 No primer for this exon
downstream ENSMUSE00000556830 Chr2:150233713..150235525 AATTTGTTGATGCCCCTGAG Chr2:150235407..150235426 59.93 45
downstream ENSMUSE00000682097 Chr2:150232877..150235525 AATTTGTTGATGCCCCTGAG Chr2:150235407..150235426 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAGTGGAAAGTAGCTTGCAG Chr2:150271160..150271181 60.06 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGTGGAAAGTAGCTTGCAG Chr2:150271160..150271181 60.06 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTGGAATAATCGCCTTGCAG Chr2:150271158..150271178 60.61 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AGTGGAACGTGACTGGGAAA Chr2:150271159..150271179 60.54 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000068130