Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33721
Trapped Gene
AC114408.18 (ENSMUSG00000079500)
Vector Insertion
Chr 5: 64042523 - 64116396
Public Clones IST13016D10 (tigm) IST10831C4 (tigm) IST15055C11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000697153 (Chr5:64042398..64042522 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000697153 (Chr5:64042398..64042522 +)
Downstram Exon
ENSMUSE00000714568 (Chr5:64116397..64116485 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TCTCTTAGTGCCTGCCGTTC Chr5:64116430..64116449 60.54 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000653306 Chr5:64040579..64041559 GGGAGTTCGAGGGAGGATAG Chr5:64040780..64040799 60.03 60
upstream ENSMUSE00000697153 Chr5:64042398..64042522 No primer for this exon

*** Putative Vector Insertion (Chr 5: 64042523 - 64116396) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000653303 Chr5:64116396..64116485 TCTCTTAGTGCCTGCCGTTC Chr5:64116430..64116449 60.54 55
downstream ENSMUSE00000714568 Chr5:64116397..64116485 TCTCTTAGTGCCTGCCGTTC Chr5:64116430..64116449 60.54 55
downstream ENSMUSE00000653302 Chr5:64136420..64136536 GCATGGACCTGCAGAAGTTT Chr5:64136533..64136552 60.26 50
downstream ENSMUSE00000711982 Chr5:64136420..64136536 GCATGGACCTGCAGAAGTTT Chr5:64136533..64136552 60.26 50
downstream ENSMUSE00000653301 Chr5:64138034..64138045 No primer for this exon
downstream ENSMUSE00000697150 Chr5:64182683..64182886 GACAGCAGCATCCAAAATCA Chr5:64182772..64182791 59.81 45
downstream ENSMUSE00000697149 Chr5:64185428..64185572 ATTTTCCCCTGTTCATGCAG Chr5:64185540..64185559 59.93 45
downstream ENSMUSE00000697148 Chr5:64191274..64191881 TCCGTGTCAAAGTTCTGCTG Chr5:64191664..64191683 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACACAAGCCTCCATTAGC Chr5:64087530..64087550 60.81 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAACATCGTGACTGGGAAA Chr5:64087567..64087587 59.54 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079500