Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33722
Trapped Gene
Abcb8 (ENSMUSG00000028973)
Vector Insertion
Chr 5: 23900402 - 23905730
Public Clones IST12234E10 (tigm) IST11826H5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000502167 (Chr5:23899973..23900401 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCTGCCCCTATCTTATTG Chr5:23900280..23900299 60.05 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000502167 (Chr5:23899973..23900401 +)
Downstram Exon
ENSMUSE00000551661 (Chr5:23905731..23906040 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCTGCCCCTATCTTATTG Chr5:23900280..23900299 60.05 50 AATGCCAGAAGAGCTTCCAA Chr5:23906002..23906021 59.96 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000701627 Chr5:23899494..23899520 TAATCCCAACACTGGGAAGG Chr5:23899494..23899513 59.78 50
upstream ENSMUSE00000502167 Chr5:23899973..23900401 TGGCTGCCCCTATCTTATTG Chr5:23900280..23900299 60.05 50
upstream ENSMUSE00000701626 Chr5:23899974..23900401 TGGCTGCCCCTATCTTATTG Chr5:23900280..23900299 60.05 50
upstream ENSMUSE00000602544 Chr5:23900214..23900401 TGGCTGCCCCTATCTTATTG Chr5:23900280..23900299 60.05 50

*** Putative Vector Insertion (Chr 5: 23900402 - 23905730) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000551661 Chr5:23905731..23906040 AATGCCAGAAGAGCTTCCAA Chr5:23906002..23906021 59.96 45
downstream ENSMUSE00000551658 Chr5:23906343..23906498 ACGGGACTCAGACACGAAAC Chr5:23906462..23906481 60.16 55
downstream ENSMUSE00000551657 Chr5:23906575..23906669 GTGGGACAGCAGCACTAGGT Chr5:23906616..23906635 60.33 60
downstream ENSMUSE00000551655 Chr5:23906793..23906898 TAGCTGCCCTGTCTTTTTGG Chr5:23906838..23906857 60.38 50
downstream ENSMUSE00000551648 Chr5:23907581..23907742 ACACCAGGCTACCAATCACC Chr5:23907623..23907642 59.85 55
downstream ENSMUSE00000551643 Chr5:23907863..23907948 AAGGGCCTCATCTGCTACAC Chr5:23907901..23907920 59.31 55
downstream ENSMUSE00000551635 Chr5:23908060..23908157 CAGCAGCATGACTCCAGTTC Chr5:23908095..23908114 59.58 55
downstream ENSMUSE00000551630 Chr5:23908891..23908996 GACATGAGGTCTCCCCCTTT Chr5:23908969..23908988 60.31 55
downstream ENSMUSE00000701616 Chr5:23909446..23909795 GATGGGGCTCAGCTAGACAG Chr5:23909558..23909577 59.97 60
downstream ENSMUSE00000551625 Chr5:23911633..23911666 GACAGAGAGGCTGGCCATAG Chr5:23911657..23911676 59.97 60
downstream ENSMUSE00000551623 Chr5:23911936..23912072 GATGGAACCACGAATGTCCT Chr5:23912052..23912071 59.79 50
downstream ENSMUSE00000470412 Chr5:23912218..23912312 AGCACATTGAAGCCAGGTCT Chr5:23912250..23912269 59.87 50
downstream ENSMUSE00000262839 Chr5:23912227..23912277 AGCACATTGAAGCCAGGTCT Chr5:23912250..23912269 59.87 50
downstream ENSMUSE00000262832 Chr5:23912279..23912312 CCCACAAGAGCCACAATCTT Chr5:23912301..23912320 60.11 50
downstream ENSMUSE00000184001 Chr5:23912486..23912619 CAGGGTCATAGAAGCGTTCC Chr5:23912533..23912552 59.69 55
downstream ENSMUSE00000183999 Chr5:23913126..23913273 CACCTCTTCATCGGAAGCAT Chr5:23913203..23913222 60.22 50
downstream ENSMUSE00000184012 Chr5:23914386..23914636 TACCACCCTCTCGGATTCTG Chr5:23914522..23914541 60.06 55
downstream ENSMUSE00000350459 Chr5:23915172..23915872 GAGAGGGTCAAGCAGAGGTG Chr5:23915564..23915583 59.99 60
downstream ENSMUSE00000443784 Chr5:23915172..23915763 GAGAGGGTCAAGCAGAGGTG Chr5:23915564..23915583 59.99 60
downstream ENSMUSE00000701606 Chr5:23915172..23915197 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGCCAGGTAAAAACACAAGA Chr5:23900397..23900417 58.82 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGAGCAACTTGGAGTGTGG Chr5:23903412..23903433 60.87 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028973