Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33730
Trapped Gene
Zdhhc19 (ENSMUSG00000052363)
Vector Insertion
Chr 16: 32496410 - 32497074
Public Clones IST12643D7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000619848 (Chr16:32496351..32496409 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGTCATTAAGGGAAAGACCA Chr16:32496362..32496382 60.17 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000619848 (Chr16:32496351..32496409 +)
Downstram Exon
ENSMUSE00000455711 (Chr16:32497075..32497318 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGTCATTAAGGGAAAGACCA Chr16:32496362..32496382 60.17 47.62 ACAGCAGCAGCGTTACATTG Chr16:32497293..32497312 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000619848 Chr16:32496351..32496409 GGGTCATTAAGGGAAAGACCA Chr16:32496362..32496382 60.17 47.62

*** Putative Vector Insertion (Chr 16: 32496410 - 32497074) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000455711 Chr16:32497075..32497318 ACAGCAGCAGCGTTACATTG Chr16:32497293..32497312 60.08 50
downstream ENSMUSE00000455696 Chr16:32497661..32497782 TGAGAAGTTGAGCGAGACGA Chr16:32497763..32497782 59.85 50
downstream ENSMUSE00000455691 Chr16:32498398..32498537 GGAAAGCCCTTTGGTTCACT Chr16:32498460..32498479 60.48 50
downstream ENSMUSE00000455689 Chr16:32499061..32499233 CAGATGCCTTGTGCGAAATA Chr16:32499210..32499229 59.83 45
downstream ENSMUSE00000619847 Chr16:32499707..32499812 CAGGAAGAGCGGAATCAAAA Chr16:32499758..32499777 60.32 45
downstream ENSMUSE00000619846 Chr16:32506033..32506118 AGGGTTGTATTCCGGATGGT Chr16:32506062..32506081 60.44 50
downstream ENSMUSE00000619845 Chr16:32506437..32506663 CTCTTGGATCCATGCTGTCC Chr16:32506497..32506516 60.62 55
downstream ENSMUSE00000619844 Chr16:32507132..32507299 AGGATGGGTAGGTCCCAAGT Chr16:32507276..32507295 59.68 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTCCACTCCGTGTGTGAG Chr16:32496427..32496447 60.78 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTTCCACTCCGTGTGTGAG Chr16:32496427..32496447 60.78 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052363