Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33739
Trapped Gene
AC129021.4-202 (ENSMUSG00000054939)
Vector Insertion
Chr 16: 3849571 - 3854210
Public Clones IST11005E8 (tigm) IST14598H2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000336152 (Chr16:3849351..3849570 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCCTGCGAAGGATCTCAC Chr16:3849481..3849500 59.95 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000336152 (Chr16:3849351..3849570 +)
Downstram Exon
ENSMUSE00000622379 (Chr16:3854211..3858880 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCCTGCGAAGGATCTCAC Chr16:3849481..3849500 59.95 55 TCCAGCACTGCTAGGGCTAT Chr16:3855293..3855312 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000296944 Chr16:3847223..3848274 CCCTAACGCGTTGTGAATTT Chr16:3847585..3847604 60 45
upstream ENSMUSE00000336152 Chr16:3849351..3849570 CTTCCTGCGAAGGATCTCAC Chr16:3849481..3849500 59.95 55

*** Putative Vector Insertion (Chr 16: 3849571 - 3854210) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000622379 Chr16:3854211..3858880 TCCAGCACTGCTAGGGCTAT Chr16:3855293..3855312 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGTGATTAATCGCCTTGCAG Chr16:3849615..3849636 60.78 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGATCGTGACTGGGAAAACC Chr16:3849618..3849638 60.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054939