Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33745
Trapped Gene
Cbfb (ENSMUSG00000031885)
Vector Insertion
Chr 8: 107702610 - 107718374
Public Clones IST14580C12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214256 (Chr8:107702493..107702609 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAACACCTAGCCGGGAATA Chr8:107702562..107702581 59.95 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214256 (Chr8:107702493..107702609 +)
Downstram Exon
ENSMUSE00000214252 (Chr8:107718375..107718491 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAACACCTAGCCGGGAATA Chr8:107702562..107702581 59.95 50 AGAATCATGGGAGCCTTCAA Chr8:107718403..107718422 59.63 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000365768 Chr8:107694574..107694953 GCAAGTTCGAGAACGAGGAG Chr8:107694904..107694923 60.13 55
upstream ENSMUSE00000214257 Chr8:107695206..107695292 No primer for this exon
upstream ENSMUSE00000214256 Chr8:107702493..107702609 CAAACACCTAGCCGGGAATA Chr8:107702562..107702581 59.95 50

*** Putative Vector Insertion (Chr 8: 107702610 - 107718374) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214252 Chr8:107718375..107718491 AGAATCATGGGAGCCTTCAA Chr8:107718403..107718422 59.63 45
downstream ENSMUSE00000237079 Chr8:107726352..107726447 CTTCAAAGGCCTGTTGTGCT Chr8:107726388..107726407 60.43 50
downstream ENSMUSE00000680120 Chr8:107726352..107726478 CTTCAAAGGCCTGTTGTGCT Chr8:107726388..107726407 60.43 50
downstream ENSMUSE00000370080 Chr8:107739804..107741886 AAAGCCTGCACTACCGAAGA Chr8:107741700..107741719 60.01 50
downstream ENSMUSE00000680118 Chr8:107739804..107741886 AAAGCCTGCACTACCGAAGA Chr8:107741700..107741719 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr8:107717660..107717680 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTGACCGTGACTGGGAAAA Chr8:107717655..107717675 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031885