Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33748
Trapped Gene
Nek10 (ENSMUSG00000042567)
Vector Insertion
Chr 14: 15819292 - 15831597
Public Clones IST14824E3 (tigm) IST14694E11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000692476 (Chr14:15819199..15819291 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCAGAGCAACCCATGTAA Chr14:15819250..15819269 59.86 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000692476 (Chr14:15819199..15819291 +)
Downstram Exon
ENSMUSE00000692483 (Chr14:15831598..15831706 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCAGAGCAACCCATGTAA Chr14:15819250..15819269 59.86 50 GTGAATGGCGAAGTGAATGA Chr14:15831673..15831692 59.65 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692509 Chr14:15653279..15653399 TGTTTTACAATGCCCGATCA Chr14:15653320..15653339 59.93 40
upstream ENSMUSE00000692508 Chr14:15653621..15653681 AAAGACTTCGGTGCCTGTTG Chr14:15653638..15653657 60.29 50
upstream ENSMUSE00000692507 Chr14:15659450..15659580 AGGACAGGGGGACATAGAGC Chr14:15659510..15659529 60.48 60
upstream ENSMUSE00000692506 Chr14:15660957..15661055 CAGCAAACATCCACAGCATC Chr14:15660984..15661003 60.27 50
upstream ENSMUSE00000692505 Chr14:15668657..15668741 AGTGGGTTAATCGTGCTCCA Chr14:15668659..15668678 60.52 50
upstream ENSMUSE00000692504 Chr14:15673077..15673118 No primer for this exon
upstream ENSMUSE00000692503 Chr14:15675300..15675378 GAGTACCTGGGCTACGCTGA Chr14:15675321..15675340 60.42 60
upstream ENSMUSE00000692502 Chr14:15676361..15676428 CTTGCTGCTGTGAAAGACCA Chr14:15676375..15676394 60.17 50
upstream ENSMUSE00000692501 Chr14:15678012..15678091 CACTGTCCTCTTGGGTGCTC Chr14:15678044..15678063 60.86 60
upstream ENSMUSE00000692500 Chr14:15679119..15679205 No primer for this exon
upstream ENSMUSE00000692499 Chr14:15683274..15683498 CCCGGAGACTAGTGTGGAAA Chr14:15683433..15683452 60.1 55
upstream ENSMUSE00000692497 Chr14:15686358..15686497 CTGGGGAAATCGAGGAAAAT Chr14:15686459..15686478 60.26 45
upstream ENSMUSE00000692495 Chr14:15688190..15688251 GATACCAATGCCCACCAAGT Chr14:15688225..15688244 59.68 50
upstream ENSMUSE00000692494 Chr14:15690297..15690374 CAATCGAATGCAGCACAAAC Chr14:15690342..15690361 60.26 45
upstream ENSMUSE00000692493 Chr14:15691809..15691873 GGAAAGGAACAGGCCACTCT Chr14:15691847..15691866 60.63 55
upstream ENSMUSE00000692492 Chr14:15693253..15693355 ACTTTTTCCCACCGACCTGT Chr14:15693253..15693272 60.78 50
upstream ENSMUSE00000692491 Chr14:15693440..15693568 GAAAGCGCCCTTGAAGTACA Chr14:15693490..15693509 60.39 50
upstream ENSMUSE00000692490 Chr14:15694065..15694202 GACCGAGACAGCAGTGTCAA Chr14:15694146..15694165 60.03 55
upstream ENSMUSE00000692488 Chr14:15695970..15696015 No primer for this exon
upstream ENSMUSE00000564971 Chr14:15697736..15698028 CCCGGGTTCTAATTTGTGAA Chr14:15697827..15697846 59.79 45
upstream ENSMUSE00000692487 Chr14:15697907..15698028 CAGTGAAGAGCGACTGTGGA Chr14:15697995..15698014 60.18 55
upstream ENSMUSE00000353022 Chr14:15698147..15698249 CAGAGATCTCACGCCAAACA Chr14:15698194..15698213 59.98 50
upstream ENSMUSE00000620171 Chr14:15717567..15717642 TGGTGGGAACGATCCTCTAT Chr14:15717618..15717637 59.36 50
upstream ENSMUSE00000491393 Chr14:15763089..15763218 TATGGAGAGAAGGCCGATGT Chr14:15763114..15763133 59.65 50
upstream ENSMUSE00000280041 Chr14:15763764..15763834 AGCCAGTGCCAGAAGGTATC Chr14:15763783..15763802 59.31 55
upstream ENSMUSE00000280032 Chr14:15770088..15770301 CAGCTAGCCTTGGAGAGGAA Chr14:15770188..15770207 59.71 55
upstream ENSMUSE00000280023 Chr14:15788009..15788192 AGCTTTCAGAGAGCGCAGAG Chr14:15788070..15788089 60.18 55
upstream ENSMUSE00000280013 Chr14:15788285..15788371 CGTCTCGGACAACTGTAGCA Chr14:15788316..15788335 60.05 55
upstream ENSMUSE00000280005 Chr14:15790065..15790119 TTTCAGTGCTTCGGGAAGAG Chr14:15790081..15790100 60.51 50
upstream ENSMUSE00000279996 Chr14:15801989..15802026 No primer for this exon
upstream ENSMUSE00000279964 Chr14:15802112..15804174 GCCTGAAAGCTGCTGTTACC Chr14:15803550..15803569 60.02 55
upstream ENSMUSE00000692479 Chr14:15802112..15802167 No primer for this exon
upstream ENSMUSE00000692486 Chr14:15811370..15811402 No primer for this exon
upstream ENSMUSE00000692485 Chr14:15813029..15813129 CTGTATCCCAGCGGAAAGTG Chr14:15813044..15813063 60.65 55
upstream ENSMUSE00000692484 Chr14:15819181..15819291 CAGCAGAGCAACCCATGTAA Chr14:15819250..15819269 59.86 50
upstream ENSMUSE00000692476 Chr14:15819199..15819291 CAGCAGAGCAACCCATGTAA Chr14:15819250..15819269 59.86 50

*** Putative Vector Insertion (Chr 14: 15819292 - 15831597) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000692483 Chr14:15831598..15831706 GTGAATGGCGAAGTGAATGA Chr14:15831673..15831692 59.65 45
downstream ENSMUSE00000692482 Chr14:15833526..15833578 TCCCTCTTCCACTTCAAAGC Chr14:15833560..15833579 59.4 50
downstream ENSMUSE00000712420 Chr14:15833659..15833718 No primer for this exon
downstream ENSMUSE00000721841 Chr14:15833659..15833718 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGCAGGATGAGGTGTTTTG Chr14:15831288..15831308 60.11 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGCAGGATGAGGTGTTTTG Chr14:15831288..15831308 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042567