Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33749
Trapped Gene
Gpr158 (ENSMUSG00000045967)
Vector Insertion
Chr 2: 21498674 - 21570583
Public Clones IST14694E11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000333403 (Chr2:21498450..21498673 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCGGCTCGCTATTATCTCT Chr2:21498585..21498604 60.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000333403 (Chr2:21498450..21498673 +)
Downstram Exon
ENSMUSE00000378626 (Chr2:21570584..21570652 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCGGCTCGCTATTATCTCT Chr2:21498585..21498604 60.1 50 TTGTTTCCAACAGGATGAGC Chr2:21570623..21570642 58.7 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000467540 Chr2:21289194..21290784 ACTGCAGACACACGAACGTC Chr2:21289304..21289323 59.95 55
upstream ENSMUSE00000720602 Chr2:21289194..21290784 ACTGCAGACACACGAACGTC Chr2:21289304..21289323 59.95 55
upstream ENSMUSE00000332534 Chr2:21320948..21321053 GTTCGAGTGATGGCTGGTTT Chr2:21320998..21321017 60.12 50
upstream ENSMUSE00000393899 Chr2:21474926..21475028 CGTGCTTGGAGCCTATCAGT Chr2:21474952..21474971 60.42 55
upstream ENSMUSE00000333403 Chr2:21498450..21498673 TGCGGCTCGCTATTATCTCT Chr2:21498585..21498604 60.1 50

*** Putative Vector Insertion (Chr 2: 21498674 - 21570583) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000378626 Chr2:21570584..21570652 TTGTTTCCAACAGGATGAGC Chr2:21570623..21570642 58.7 45
downstream ENSMUSE00000422954 Chr2:21668303..21668412 AAGAAGACGAGCCCACCTTA Chr2:21668371..21668390 58.93 50
downstream ENSMUSE00000422949 Chr2:21704691..21704929 TTTGTGCTGTTCGTGAAAGG Chr2:21704728..21704747 59.88 45
downstream ENSMUSE00000401855 Chr2:21732178..21732316 TAAATGCCCCACAAGAGGAA Chr2:21732211..21732230 60.44 45
downstream ENSMUSE00000660851 Chr2:21732178..21733315 ATGTCAGCAGGGGAGTCAAC Chr2:21733147..21733166 60.12 55
downstream ENSMUSE00000342867 Chr2:21737213..21737318 AATTAGAAGCAGCCCAATGGT Chr2:21737314..21737334 59.98 42.86
downstream ENSMUSE00000403609 Chr2:21746771..21746917 TCCGTAGCAATGTCATCTCG Chr2:21746817..21746836 59.82 50
downstream ENSMUSE00000605168 Chr2:21747863..21752171 CACTCGCATGCAGAAACCTA Chr2:21751948..21751967 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr2:21534724..21534744 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATATACCCGTGACTGGGAAAAC Chr2:21522718..21522740 59.14 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000045967