Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33750
Trapped Gene
Odz3 (ENSMUSG00000031561)
Vector Insertion
Chr 8: 49325598 - 49340000
Public Clones IST14824E3 (tigm) IST14694E11 (tigm) IST14915E4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 63% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000448330 (Chr8:49339764..49339999 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAGGGCAAAGTCAACGTAT Chr8:49339781..49339800 59.99 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000448330 (Chr8:49339764..49339999 -)
Downstram Exon
ENSMUSE00000448322 (Chr8:49325599..49325895 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAGGGCAAAGTCAACGTAT Chr8:49339781..49339800 59.99 50 CTTGGTGGTCCGATCAAAGT Chr8:49325826..49325845 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000683597 Chr8:49929132..49929268 GAGCGGAGGAGTCAAGGATT Chr8:49929205..49929224 60.74 55
upstream ENSMUSE00000473700 Chr8:49759764..49760044 ATGATTCTTCACGGCTGCTT Chr8:49759822..49759841 59.84 45
upstream ENSMUSE00000683596 Chr8:49759570..49760076 ATGATTCTTCACGGCTGCTT Chr8:49759822..49759841 59.84 45
upstream ENSMUSE00000494413 Chr8:49731612..49731890 ACGAGAACAGGTCGGACAGT Chr8:49731619..49731638 59.76 55
upstream ENSMUSE00000683598 Chr8:49641232..49641393 No primer for this exon
upstream ENSMUSE00000683604 Chr8:49641069..49641200 GTGTGATGAAGCCTGTGCTG Chr8:49641132..49641151 60.47 55
upstream ENSMUSE00000683611 Chr8:49640507..49641047 GCGTGAGTGTGTGTGTGTGT Chr8:49640924..49640943 59.2 55
upstream ENSMUSE00000491981 Chr8:49502362..49502599 CGTCCATCACTTCCCTCAAT Chr8:49502499..49502518 59.93 50
upstream ENSMUSE00000683610 Chr8:49502362..49502599 CGTCCATCACTTCCCTCAAT Chr8:49502499..49502518 59.93 50
upstream ENSMUSE00000683616 Chr8:49502362..49502603 CGTCCATCACTTCCCTCAAT Chr8:49502499..49502518 59.93 50
upstream ENSMUSE00000498613 Chr8:49480790..49481028 GCTGTAGGGGTCTCAGTGCT Chr8:49480819..49480838 59.48 60
upstream ENSMUSE00000712351 Chr8:49480790..49481028 GCTGTAGGGGTCTCAGTGCT Chr8:49480819..49480838 59.48 60
upstream ENSMUSE00000720986 Chr8:49480790..49481028 GCTGTAGGGGTCTCAGTGCT Chr8:49480819..49480838 59.48 60
upstream ENSMUSE00000496270 Chr8:49452665..49452787 CGTTACCTTCTGGCGACAAT Chr8:49452666..49452685 60.13 50
upstream ENSMUSE00000517019 Chr8:49434553..49434767 TACCGCCTTCCCATACTCAG Chr8:49434553..49434572 60.09 55
upstream ENSMUSE00000515724 Chr8:49428586..49428796 AAAACCCAGAGCAGGTCTCC Chr8:49428605..49428624 60.63 55
upstream ENSMUSE00000521004 Chr8:49427969..49428070 GGGTTTCTAGGTCCGGATTG Chr8:49427977..49427996 60.68 55
upstream ENSMUSE00000582361 Chr8:49427611..49427805 GGCTCTTGCGCTTGTAACTC Chr8:49427640..49427659 60.16 55
upstream ENSMUSE00000480622 Chr8:49426308..49426508 ATCACGGGGTGTGTATCCAT Chr8:49426462..49426481 59.93 50
upstream ENSMUSE00000582360 Chr8:49420943..49421128 GGCGTGTAATCAGAGAGCTTG Chr8:49421029..49421049 60.03 52.38
upstream ENSMUSE00000683607 Chr8:49420107..49421128 AGCCGTCTGTCACCAGACTT Chr8:49420834..49420853 59.91 55
upstream ENSMUSE00000501367 Chr8:49398592..49398618 No primer for this exon
upstream ENSMUSE00000582359 Chr8:49395977..49396123 GAGATGCACACTGGACCAAA Chr8:49396073..49396092 59.68 50
upstream ENSMUSE00000503811 Chr8:49386109..49386325 TCCTGATTGGATCGGATAGC Chr8:49386147..49386166 60 50
upstream ENSMUSE00000265168 Chr8:49384948..49385067 TATACCATTACCCGCCAGGA Chr8:49384954..49384973 60.17 50
upstream ENSMUSE00000582358 Chr8:49384140..49384401 TATTTGAGCGTTCCCCATTC Chr8:49384341..49384360 59.9 45
upstream ENSMUSE00000265150 Chr8:49378861..49379128 CCAAACTTGGCCTACACGTT Chr8:49378920..49378939 60.03 50
upstream ENSMUSE00000265144 Chr8:49377473..49377616 GTCCGTCGGATACGAGTACG Chr8:49377596..49377615 60.54 60
upstream ENSMUSE00000265138 Chr8:49373145..49373394 CAAGCTGACGGGAACAAACT Chr8:49373259..49373278 60.29 50
upstream ENSMUSE00000396569 Chr8:49372487..49372507 No primer for this exon
upstream ENSMUSE00000265121 Chr8:49364312..49364544 AACACCCGCAGAATCTATCG Chr8:49364455..49364474 60.1 50
upstream ENSMUSE00000582357 Chr8:49363021..49363175 CGTCAGCTCGACCTTTAACC Chr8:49363048..49363067 59.88 55
upstream ENSMUSE00000265104 Chr8:49361384..49362258 ACCAACGGGTGTCTGAAAAG Chr8:49361486..49361505 60.01 50
upstream ENSMUSE00000448341 Chr8:49342186..49342361 ACAAGGCTATCACGGTGGAC Chr8:49342268..49342287 60 55
upstream ENSMUSE00000448330 Chr8:49339764..49339999 CCAGGGCAAAGTCAACGTAT Chr8:49339781..49339800 59.99 50
upstream ENSMUSE00000448322 Chr8:49325599..49325895 ACTTTGATCGGACCACCAAG Chr8:49325848..49325867 59.97 50

*** Putative Vector Insertion (Chr 8: 49325598 - 49340000) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000448312 Chr8:49320644..49322255 TTACCCGGCCCATATTATCA Chr8:49321498..49321517 60 45
downstream ENSMUSE00000448303 Chr8:49317362..49317492 AGATGGAAGCCAAACGTCAC Chr8:49317434..49317453 60.12 50
downstream ENSMUSE00000683615 Chr8:49313059..49314555 AGAGTCCGGTTTGGATTGTG Chr8:49313724..49313743 59.97 50
downstream ENSMUSE00000607823 Chr8:49313036..49314555 AGAGTCCGGTTTGGATTGTG Chr8:49313724..49313743 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGCAAAATAATTCCCAGCAG Chr8:49334024..49334044 60.58 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGCAAAATAATTCCCAGCAG Chr8:49334024..49334044 60.58 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031561