Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33759
Trapped Gene
Fam171a1 (ENSMUSG00000050530)
Vector Insertion
Chr 2: 3036208 - 3095507
Public Clones (sanger) IST11978G10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000458722 (Chr2:3036126..3036207 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCTGGTGACTCTTCGGCTTA Chr2:3036180..3036199 60.54 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000458722 (Chr2:3036126..3036207 +)
Downstram Exon
ENSMUSE00000570334 (Chr2:3095508..3095735 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCTGGTGACTCTTCGGCTTA Chr2:3036180..3036199 60.54 55 GTGCTGGCGTCACTAATGTG Chr2:3095547..3095566 60.33 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000458787 Chr2:3031496..3031537 TGATGGTCGGAACATGAGAA Chr2:3031514..3031533 60.05 45
upstream ENSMUSE00000701680 Chr2:3035660..3035924 GTTTGGAAGGCAGTCACCAA Chr2:3035873..3035892 61.08 50
upstream ENSMUSE00000647941 Chr2:3035685..3035924 GTTTGGAAGGCAGTCACCAA Chr2:3035873..3035892 61.08 50
upstream ENSMUSE00000458722 Chr2:3036126..3036207 GCTGGTGACTCTTCGGCTTA Chr2:3036180..3036199 60.54 55

*** Putative Vector Insertion (Chr 2: 3036208 - 3095507) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000570326 Chr2:3095508..3095735 GTGCTGGCGTCACTAATGTG Chr2:3095547..3095566 60.33 55
downstream ENSMUSE00000570334 Chr2:3095508..3095735 GTGCTGGCGTCACTAATGTG Chr2:3095547..3095566 60.33 55
downstream ENSMUSE00000647939 Chr2:3103695..3103787 CCAAGGCTCAGTGAGGAAAA Chr2:3103719..3103738 60.37 50
downstream ENSMUSE00000647946 Chr2:3103695..3103787 CCAAGGCTCAGTGAGGAAAA Chr2:3103719..3103738 60.37 50
downstream ENSMUSE00000647945 Chr2:3114549..3114707 TCGCAAGTAAGGGAAGCTGT Chr2:3114688..3114707 60.01 50
downstream ENSMUSE00000647944 Chr2:3119817..3119993 CATAGGCATTGTGCCTCAGA Chr2:3119966..3119985 59.82 50
downstream ENSMUSE00000647943 Chr2:3137525..3137641 ATGTACGTCCACGTGAGCTG Chr2:3137594..3137613 59.78 55
downstream ENSMUSE00000647940 Chr2:3140742..3140856 CCAAAAGAAACACCGTGTGA Chr2:3140795..3140814 59.58 45
downstream ENSMUSE00000339365 Chr2:3142090..3145071 CCTGCTCAGCCCATACTCTC Chr2:3144944..3144963 59.97 60
downstream ENSMUSE00000570322 Chr2:3142090..3144522 CTTCATCATTGGCGGATCTT Chr2:3143684..3143703 60.04 45
downstream ENSMUSE00000570329 Chr2:3142090..3144524 CTTCATCATTGGCGGATCTT Chr2:3143684..3143703 60.04 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGTGCTTTTTGCAATCAT Chr2:3093240..3093260 58.77 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGATGTGTTTGAGTGCCTGT Chr2:3093180..3093200 59.75 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050530