Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33766
Trapped Gene
Gla (ENSMUSG00000031266)
Vector Insertion
Chr X: 131125484 - 131126766
Public Clones IST10490A11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000207767 (ChrX:131126604..131126765 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCTGGAATGACCCAGACAT ChrX:131126605..131126624 59.53 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000207767 (ChrX:131126604..131126765 -)
Downstram Exon
ENSMUSE00000207764 (ChrX:131125485..131125682 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCTGGAATGACCCAGACAT ChrX:131126605..131126624 59.53 50 GCAGAGCTTTGGCTTGAGAG ChrX:131125531..131125550 60.42 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000352917 ChrX:131135277..131135494 GAGCATTCTTGGGGTCAGAG ChrX:131135380..131135399 59.8 55
upstream ENSMUSE00000207762 ChrX:131130814..131130988 GGATCAAACACCTCGCAAAT ChrX:131130817..131130836 59.94 45
upstream ENSMUSE00000277094 ChrX:131129719..131129896 ACTGGGGCGTAGATCTGCTA ChrX:131129765..131129784 59.86 55
upstream ENSMUSE00000207760 ChrX:131128173..131128264 GGCCGAAGCATTGTATACTCC ChrX:131128209..131128229 60.83 52.38
upstream ENSMUSE00000207767 ChrX:131126604..131126765 AGCTGGAATGACCCAGACAT ChrX:131126605..131126624 59.53 50
upstream ENSMUSE00000207764 ChrX:131125485..131125682 GCTCCCCTACTCATGTCCAA ChrX:131125591..131125610 60.07 55

*** Putative Vector Insertion (Chr X: 131125484 - 131126766) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000277059 ChrX:131122895..131124666 TCTCGGGGAGAAGCTGAGTA ChrX:131124473..131124492 60.09 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC ChrX:131126695..131126715 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATTTTGCGTGACTGGGAAA ChrX:131126702..131126722 60.48 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031266