Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33788
Trapped Gene
St6galnac6 (ENSMUSG00000026811)
Vector Insertion
Chr 2: 32455357 - 32462530
Public Clones (sanger) IST14410B10 (tigm) IST14520B9 (tigm) IST14410B10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000603960 (Chr2:32455229..32455356 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTGGCACAGCGTCTACTGA Chr2:32455272..32455291 60.06 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000603960 (Chr2:32455229..32455356 +)
Downstram Exon
ENSMUSE00000706813 (Chr2:32462531..32462625 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTGGCACAGCGTCTACTGA Chr2:32455272..32455291 60.06 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000603960 Chr2:32455229..32455356 GTTGGCACAGCGTCTACTGA Chr2:32455272..32455291 60.06 55

*** Putative Vector Insertion (Chr 2: 32455357 - 32462530) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000695046 Chr2:32462481..32462631 No primer for this exon
downstream ENSMUSE00000695044 Chr2:32462531..32462631 No primer for this exon
downstream ENSMUSE00000706813 Chr2:32462531..32462625 No primer for this exon
downstream ENSMUSE00000695049 Chr2:32462546..32462631 No primer for this exon
downstream ENSMUSE00000695040 Chr2:32463556..32463745 CTCAGCCAGGACTACGGTTC Chr2:32463730..32463749 59.87 60
downstream ENSMUSE00000695043 Chr2:32463562..32463745 CTCAGCCAGGACTACGGTTC Chr2:32463730..32463749 59.87 60
downstream ENSMUSE00000695048 Chr2:32463562..32463616 GCAAGCCATGTGACCTCTCT Chr2:32463602..32463621 60.42 55
downstream ENSMUSE00000163071 Chr2:32463591..32463616 No primer for this exon
downstream ENSMUSE00000645887 Chr2:32464046..32464077 No primer for this exon
downstream ENSMUSE00000645888 Chr2:32464746..32464836 GCGTCTGCTGAAGGGTAGAG Chr2:32464815..32464834 60.16 60
downstream ENSMUSE00000695045 Chr2:32464746..32464836 GCGTCTGCTGAAGGGTAGAG Chr2:32464815..32464834 60.16 60
downstream ENSMUSE00000722288 Chr2:32464746..32464836 GCGTCTGCTGAAGGGTAGAG Chr2:32464815..32464834 60.16 60
downstream ENSMUSE00000706814 Chr2:32467744..32467923 TGGCACTGTTGGAGCTGTAG Chr2:32467822..32467841 60.05 55
downstream ENSMUSE00000163077 Chr2:32470301..32470707 GGAAGAGGTCGTCAAACTGC Chr2:32470688..32470707 59.85 55
downstream ENSMUSE00000695042 Chr2:32470301..32470440 TGATCACACACTGGTTGCAC Chr2:32470337..32470356 59.1 50
downstream ENSMUSE00000163069 Chr2:32474017..32474124 GCACATGGTCACACAATTCC Chr2:32474093..32474112 59.82 50
downstream ENSMUSE00000480091 Chr2:32474860..32476324 AGAACCCAGTCCCCATCTCT Chr2:32476101..32476120 59.93 55
downstream ENSMUSE00000603954 Chr2:32474860..32476326 AGAACCCAGTCCCCATCTCT Chr2:32476101..32476120 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACATCTAATCGCCTTGCAG Chr2:32461402..32461422 59.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATATGCACATCCGTGACTGG Chr2:32461397..32461417 59.4 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026811