Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33807
Trapped Gene
Gm1631 (ENSMUSG00000064263)
Vector Insertion
Chr 2: 71557566 - 71561346
Public Clones IST12014A3 (tigm) IST14601A8 (tigm) IST10677D11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000492955 (Chr2:71557474..71557565 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTGCATGGAGAGGAACCAG Chr2:71557533..71557552 60.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000492955 (Chr2:71557474..71557565 +)
Downstram Exon
ENSMUSE00000503171 (Chr2:71561347..71561553 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTGCATGGAGAGGAACCAG Chr2:71557533..71557552 60.26 55 CTGATTGCTGCTTGAGCTTG Chr2:71561375..71561394 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690502 Chr2:71557446..71557565 AGTGCATGGAGAGGAACCAG Chr2:71557533..71557552 60.26 55
upstream ENSMUSE00000492955 Chr2:71557474..71557565 AGTGCATGGAGAGGAACCAG Chr2:71557533..71557552 60.26 55

*** Putative Vector Insertion (Chr 2: 71557566 - 71561346) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000503171 Chr2:71561347..71561553 CTGATTGCTGCTTGAGCTTG Chr2:71561375..71561394 59.89 50
downstream ENSMUSE00000506080 Chr2:71568407..71568490 TCCAACACCAGGCTAGAACA Chr2:71568474..71568493 59.29 50
downstream ENSMUSE00000690501 Chr2:71568407..71568489 TCCAACACCAGGCTAGAACA Chr2:71568474..71568493 59.29 50
downstream ENSMUSE00000690500 Chr2:71568766..71569023 TTGCATATTCCACTCGCTTG Chr2:71568854..71568873 59.83 45
downstream ENSMUSE00000690503 Chr2:71568767..71568955 TTGCATATTCCACTCGCTTG Chr2:71568854..71568873 59.83 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGCAAGGAAGGAAAAGAAAA Chr2:71560562..71560583 58.97 33.33 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTGCATGGAGAGGAACCAG Chr2:71560534..71560554 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000064263