Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33820
Trapped Gene
CT030728.6-202 (ENSMUSG00000073403)
Vector Insertion
Chr 17: 36282332 - 36282869
Public Clones IST10434F3 (tigm) IST12903B7 (tigm) IST14285D5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000570652 (Chr17:36282805..36282868 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000570652 (Chr17:36282805..36282868 -)
Downstram Exon
ENSMUSE00000570650 (Chr17:36282333..36282602 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CACGTAGCCGACAGAGATGA Chr17:36282498..36282517 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000570652 Chr17:36282805..36282868 No primer for this exon
upstream ENSMUSE00000570650 Chr17:36282333..36282602 TCATCTCTGTCGGCTACGTG Chr17:36282520..36282539 60.01 55

*** Putative Vector Insertion (Chr 17: 36282332 - 36282869) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000487918 Chr17:36281857..36282132 CGTTCAGGGCGATGTAATCT Chr17:36282000..36282019 60.1 50
downstream ENSMUSE00000657379 Chr17:36280097..36280372 GCTCTATGTCCTGGGTCAGC Chr17:36280210..36280229 59.83 60
downstream ENSMUSE00000543914 Chr17:36279933..36279969 No primer for this exon
downstream ENSMUSE00000470937 Chr17:36279656..36279735 TGATCACAGCTCCAAGGACA Chr17:36279682..36279701 60.4 50
downstream ENSMUSE00000657378 Chr17:36279444..36279476 GGAGCATAGTCCCCTCCTTT Chr17:36279430..36279449 59.54 55
downstream ENSMUSE00000696817 Chr17:36279277..36279324 CCCCAGAAACAAGTCAGAGC Chr17:36279265..36279284 59.84 55
downstream ENSMUSE00000696816 Chr17:36278703..36278978 ATGCAGATGTCCCCTAGTGC Chr17:36278916..36278935 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATGCCCTGTATCCCAGATG Chr17:36282872..36282892 59.77 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATGCCCTGTATCCCAGATG Chr17:36282872..36282892 59.77 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000073403