Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33825
Trapped Gene
Ank3 (ENSMUSG00000069601)
Vector Insertion
Chr 10: 68997033 - 69169221
Public Clones IST14251B7 (tigm) IST15112H7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000521172 (Chr10:68996970..68997032 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAAGCCTGCTCATAGGAAG Chr10:68996998..68997017 59.97 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000521172 (Chr10:68996970..68997032 +)
Downstram Exon
ENSMUSE00000612188 (Chr10:69169222..69169673 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAAGCCTGCTCATAGGAAG Chr10:68996998..68997017 59.97 55 GGGCCAGATCTCATCCTACA Chr10:69169368..69169387 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000521172 Chr10:68996970..68997032 CCAAGCCTGCTCATAGGAAG Chr10:68996998..68997017 59.97 55

*** Putative Vector Insertion (Chr 10: 68997033 - 69169221) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000612188 Chr10:69169222..69169673 GGGCCAGATCTCATCCTACA Chr10:69169368..69169387 60.03 55
downstream ENSMUSE00000612180 Chr10:69271160..69271265 CTTGCGTTGGCATCAGACTA Chr10:69271183..69271202 60.01 50
downstream ENSMUSE00000375373 Chr10:69271164..69271265 TAACTTGCGTTGGCATCAGA Chr10:69271186..69271205 60.4 45
downstream ENSMUSE00000642824 Chr10:69271621..69271719 GCAGCTCAGAGACCACTTCC Chr10:69271687..69271706 60.14 60
downstream ENSMUSE00000642823 Chr10:69271919..69272017 ATGTGTAAGGCCGTGTTTCC Chr10:69271944..69271963 59.86 50
downstream ENSMUSE00000642822 Chr10:69278443..69278541 CTGACGACTTCCAGGTGGTT Chr10:69278501..69278520 60.15 55
downstream ENSMUSE00000288701 Chr10:69284956..69285141 GAGGGACACGACTTGGTCAT Chr10:69285018..69285037 59.97 55
downstream ENSMUSE00000288693 Chr10:69287066..69287164 CTCGGTTTAACAGCAACGTG Chr10:69287141..69287160 59.39 50
downstream ENSMUSE00000288686 Chr10:69312854..69312952 AGGCAACGTGTAAGGGAGTG Chr10:69312884..69312903 60.17 55
downstream ENSMUSE00000642761 Chr10:69320968..69321024 CCTGATTGTGCCACTGTTCA Chr10:69320994..69321013 60.72 50
downstream ENSMUSE00000575782 Chr10:69330133..69330231 CGGATCTGTCAAGCAACATC Chr10:69330211..69330230 59.24 50
downstream ENSMUSE00000575781 Chr10:69333750..69333947 AACTTTGTAATGGCCGCAGT Chr10:69333902..69333921 59.64 45
downstream ENSMUSE00000612185 Chr10:69337538..69337636 CATTACTCGGATGCGGTTCT Chr10:69337594..69337613 60.1 50
downstream ENSMUSE00000612184 Chr10:69340578..69340676 CAACATGGATTGGGGTAAGG Chr10:69340605..69340624 60.04 50
downstream ENSMUSE00000575778 Chr10:69342641..69342739 GACCAGATACCGCACCACTT Chr10:69342709..69342728 60 55
downstream ENSMUSE00000575777 Chr10:69345109..69345306 TGTGGAGTGGAGTCTGGTCA Chr10:69345133..69345152 60.29 55
downstream ENSMUSE00000575775 Chr10:69347495..69347593 GGAGACTTGCGACTTCAAGC Chr10:69347558..69347577 60.14 55
downstream ENSMUSE00000575773 Chr10:69347887..69347985 GGGCCACTTTCTGATTATCG Chr10:69347944..69347963 59.53 50
downstream ENSMUSE00000575772 Chr10:69355070..69355267 TTTGCATCAGCACCGTACTC Chr10:69355158..69355177 59.87 50
downstream ENSMUSE00000575771 Chr10:69356193..69356291 TCACTCGGTCTTCTTGAGCA Chr10:69356241..69356260 59.7 50
downstream ENSMUSE00000575770 Chr10:69360789..69360887 TAGTGACAGCCCACATGGAG Chr10:69360826..69360845 59.7 55
downstream ENSMUSE00000575769 Chr10:69360976..69361074 CCTGGTGCAGTGCTGTGTAT Chr10:69361003..69361022 59.78 55
downstream ENSMUSE00000288578 Chr10:69361742..69361837 GTGTGTCAACCACCGAGATG Chr10:69361805..69361824 60.01 55
downstream ENSMUSE00000349549 Chr10:69366946..69367018 TTTTGTGCTTCTCCGTGATG Chr10:69366970..69366989 59.84 45
downstream ENSMUSE00000403576 Chr10:69367196..69367258 TCCCCATCACTGAGCTTTTC Chr10:69367238..69367257 60.19 50
downstream ENSMUSE00000575767 Chr10:69383186..69383239 TGGGAATTTTGAACCATGTG Chr10:69383218..69383237 59.22 40
downstream ENSMUSE00000612178 Chr10:69388280..69388939 GACCGAAACATGCGAAAAAT Chr10:69388671..69388690 59.94 40
downstream ENSMUSE00000642814 Chr10:69390443..69390566 CTGTGGCCCGAGATACTTGT Chr10:69390492..69390511 60.13 55
downstream ENSMUSE00000642809 Chr10:69395142..69395244 CCTTGCGTAGGAGCTTCTGT Chr10:69395202..69395221 59.64 55
downstream ENSMUSE00000642808 Chr10:69413700..69413806 AACTCCCTCGTGAACGTCAG Chr10:69413725..69413744 60.3 55
downstream ENSMUSE00000642807 Chr10:69418674..69418898 TGGCTAATCCCTCTCCTTCC Chr10:69418858..69418877 60.54 55
downstream ENSMUSE00000642806 Chr10:69421666..69421820 CGCGAGGTCTTCGTTTTTAC Chr10:69421798..69421817 59.88 50
downstream ENSMUSE00000642805 Chr10:69436470..69436681 AGATGCGCTTTGTACCCAAC Chr10:69436511..69436530 60.14 50
downstream ENSMUSE00000642803 Chr10:69438796..69439003 GGTCATGGTGATCGGCTTAT Chr10:69438915..69438934 59.78 50
downstream ENSMUSE00000642802 Chr10:69440461..69440557 GCTGAAACGTTGGTTGTGAA Chr10:69440557..69440576 59.74 45
downstream ENSMUSE00000642801 Chr10:69441219..69441447 GAGGCTAGCCCTACGGTCTC Chr10:69441272..69441291 60.37 65
downstream ENSMUSE00000642799 Chr10:69442066..69442191 TCAACGTAGATGGGCTTTCC Chr10:69442097..69442116 60.07 50
downstream ENSMUSE00000642798 Chr10:69443020..69443142 TTGGGGTAATCCCTTTGTTG Chr10:69443100..69443119 59.66 45
downstream ENSMUSE00000612183 Chr10:69443572..69443598 No primer for this exon
downstream ENSMUSE00000642794 Chr10:69444864..69444945 TCATGCTGGGTTCAGTCAAG Chr10:69444948..69444967 59.83 50
downstream ENSMUSE00000612182 Chr10:69448837..69456510 AATAACGGCTTAGGGCCTGT Chr10:69450832..69450851 59.99 50
downstream ENSMUSE00000642792 Chr10:69457120..69457194 GGCTACTATCGCCATCCTGA Chr10:69457172..69457191 60.2 55
downstream ENSMUSE00000642790 Chr10:69460843..69460974 GAATTGGGATTTTCCACACG Chr10:69460912..69460931 60.17 45
downstream ENSMUSE00000642789 Chr10:69462103..69462246 TTGGTCCTTCCAGCAGAGTT Chr10:69462174..69462193 59.84 50
downstream ENSMUSE00000642788 Chr10:69464671..69465349 GGCCGGGTCTGTTACAGTTA Chr10:69464936..69464955 59.99 55
downstream ENSMUSE00000464458 Chr10:69465259..69465349 TCATCCAGACGGTCCAGTAA Chr10:69465349..69465368 59.09 50
downstream ENSMUSE00000642778 Chr10:69467358..69467705 ACAGGCACACAGGGTTTAGG Chr10:69467651..69467670 60.03 55
downstream ENSMUSE00000642786 Chr10:69467358..69467739 ACAGGCACACAGGGTTTAGG Chr10:69467651..69467670 60.03 55
downstream ENSMUSE00000612181 Chr10:69478282..69478378 CCGGATTTCCTTCTTCGTCT Chr10:69478360..69478379 60.57 50
downstream ENSMUSE00000520253 Chr10:69478316..69478401 CCGGATTTCCTTCTTCGTCT Chr10:69478360..69478379 60.57 50
downstream ENSMUSE00000612179 Chr10:69486580..69490184 GTGTTTTCGGGAGAGAGCAG Chr10:69488262..69488281 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCATCTGACCACCTGAGAC Chr10:69141060..69141080 59.83 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGCCCTCCTGTTAGAGCTG Chr10:69122990..69123010 60.15 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069601