Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33829
Trapped Gene
Kcnk7 (ENSMUSG00000024936)
Vector Insertion
Chr 19: 5704795 - 5706066
Public Clones IST10002H4 (tigm) IST10002H4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696378 (Chr19:5704475..5704794 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGATACCTGCTCCTGCTTATG Chr19:5704500..5704520 59.88 52.38 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696378 (Chr19:5704475..5704794 +)
Downstram Exon
ENSMUSE00000146392 (Chr19:5706067..5706465 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGATACCTGCTCCTGCTTATG Chr19:5704500..5704520 59.88 52.38 ACTGCCCAAGGTGGTAAATG Chr19:5706456..5706475 59.85 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000146391 Chr19:5704367..5704794 TGGCTTAGCCTACTCCCTCA Chr19:5704432..5704451 59.97 55
upstream ENSMUSE00000696378 Chr19:5704475..5704794 CGATACCTGCTCCTGCTTATG Chr19:5704500..5704520 59.88 52.38

*** Putative Vector Insertion (Chr 19: 5704795 - 5706066) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000146392 Chr19:5706067..5706465 ACTGCCCAAGGTGGTAAATG Chr19:5706456..5706475 59.85 50
downstream ENSMUSE00000494022 Chr19:5706703..5707100 GCTGGGGTCTGTTCTGATGT Chr19:5706939..5706958 60.12 55
downstream ENSMUSE00000696376 Chr19:5706703..5706904 TGCCATCTTGATCTTCATCG Chr19:5706834..5706853 59.76 45
downstream ENSMUSE00000696375 Chr19:5706988..5707100 ATTCCCATAACCCCTTCCTG Chr19:5707048..5707067 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000024936