Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33835
Trapped Gene
Map3k5 (ENSMUSG00000071369)
Vector Insertion
Chr 10: 19749010 - 19766177
Public Clones IST14246H10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000615827 (Chr10:19748839..19749009 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCACTGACACGGAAAGCAG Chr10:19748972..19748991 60.03 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000615827 (Chr10:19748839..19749009 +)
Downstram Exon
ENSMUSE00000615826 (Chr10:19766178..19766290 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCACTGACACGGAAAGCAG Chr10:19748972..19748991 60.03 50 GCCAGCAAGAGAACTGCATA Chr10:19766249..19766268 59.18 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000615833 Chr10:19654278..19654880 TACCACCGTGGCTTATGTGA Chr10:19654702..19654721 59.99 50
upstream ENSMUSE00000714514 Chr10:19654332..19654880 TACCACCGTGGCTTATGTGA Chr10:19654702..19654721 59.99 50
upstream ENSMUSE00000615832 Chr10:19720372..19720511 GGCCAACAACATCATCCTCT Chr10:19720454..19720473 59.93 50
upstream ENSMUSE00000615831 Chr10:19739364..19739387 No primer for this exon
upstream ENSMUSE00000615830 Chr10:19743414..19743607 ACCGTTTCGTTCAGCTTTTG Chr10:19743565..19743584 60.28 45
upstream ENSMUSE00000615829 Chr10:19744691..19744859 CTTCCGGGAATCCATACTCA Chr10:19744697..19744716 59.89 50
upstream ENSMUSE00000615828 Chr10:19745987..19746093 TTTCATTACGCATTTGCACTG Chr10:19746068..19746088 59.76 38.1
upstream ENSMUSE00000615827 Chr10:19748839..19749009 TTCACTGACACGGAAAGCAG Chr10:19748972..19748991 60.03 50

*** Putative Vector Insertion (Chr 10: 19749010 - 19766177) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000615826 Chr10:19766178..19766290 GCCAGCAAGAGAACTGCATA Chr10:19766249..19766268 59.18 50
downstream ENSMUSE00000615825 Chr10:19776281..19776440 TCCCCTTTTTACCCAGAAGG Chr10:19776319..19776338 60.28 50
downstream ENSMUSE00000615824 Chr10:19778743..19778896 CCATCCAGAAGTCCACGAGT Chr10:19778849..19778868 60.11 55
downstream ENSMUSE00000615823 Chr10:19787635..19787742 CAGGGAGAACATGCCAAATAG Chr10:19787736..19787756 59.58 47.62
downstream ENSMUSE00000615822 Chr10:19796288..19796337 GAAGCACCGAAGTTCCACTC Chr10:19796322..19796341 59.85 55
downstream ENSMUSE00000615821 Chr10:19799048..19799143 GGAAACAGCATCGTTCTTCA Chr10:19799082..19799101 58.85 45
downstream ENSMUSE00000615820 Chr10:19802193..19802274 CAGGGAGTCACCCTCACAGT Chr10:19802274..19802293 60.15 60
downstream ENSMUSE00000615819 Chr10:19814168..19814301 AAGTGCCCTTCCCTAACACA Chr10:19814225..19814244 59.59 50
downstream ENSMUSE00000615818 Chr10:19819311..19819438 GAAGCCGTTCTCACTGAAGG Chr10:19819410..19819429 59.99 55
downstream ENSMUSE00000615817 Chr10:19819867..19820003 CCCATTTTGAACGAAGGAGA Chr10:19819902..19819921 60.04 45
downstream ENSMUSE00000615816 Chr10:19823966..19824071 GGATGTCCCGAAGTCAGAGA Chr10:19824031..19824050 60.2 55
downstream ENSMUSE00000615815 Chr10:19827955..19828112 CCATTTCGATGATTGTGCAG Chr10:19828059..19828078 60.07 45
downstream ENSMUSE00000615814 Chr10:19830524..19830701 GGCTCTCTTGTCAGGGTCTG Chr10:19830628..19830647 59.99 60
downstream ENSMUSE00000666571 Chr10:19831584..19831604 No primer for this exon
downstream ENSMUSE00000615813 Chr10:19837951..19838128 CCCAGGAACAATGTCCGTAT Chr10:19838131..19838150 59.67 50
downstream ENSMUSE00000615812 Chr10:19838221..19838389 CTGGTCTTCGGTCAGGATTC Chr10:19838353..19838372 59.65 55
downstream ENSMUSE00000615811 Chr10:19844758..19844943 TTTTTCGGTCAGTGGACCTC Chr10:19844848..19844867 60.09 50
downstream ENSMUSE00000615810 Chr10:19847458..19847563 CATCCAGTGTGGCTTGATGT Chr10:19847505..19847524 59.55 50
downstream ENSMUSE00000615809 Chr10:19851771..19852014 CGTCGGACTGTCTGATTTGA Chr10:19851882..19851901 59.83 50
downstream ENSMUSE00000615808 Chr10:19856700..19856812 CTTTCCGAACCAGCTCTTCA Chr10:19856728..19856747 60.51 50
downstream ENSMUSE00000615807 Chr10:19858069..19858181 TCAGAATCTTCCGTGGTCGT Chr10:19858132..19858151 60.66 50
downstream ENSMUSE00000615806 Chr10:19860455..19860531 No primer for this exon
downstream ENSMUSE00000615805 Chr10:19861329..19861529 TCAGGCTCTCCAGTCAAGGT Chr10:19861423..19861442 59.99 55
downstream ENSMUSE00000717496 Chr10:19861329..19861476 TCAGGCTCTCCAGTCAAGGT Chr10:19861423..19861442 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTTCTTGCTCCCCTGTGAT Chr10:19755034..19755054 59.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAAACGTGACTGGGAAAACC Chr10:19755057..19755077 58.93 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071369