Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3389
Trapped Gene
Myst4 (ENSMUSG00000021767)
Vector Insertion
Chr 14: 22339527 - 22428975
Public Clones (sanger) AN0683 (sanger) (sanger) XP0100 (sanger) D068A12 (ggtc)
D068A12 (ggtc) IST13793F1 (tigm) IST14530C10 (tigm)
Private Clones OST426231 (lexicon) OST411248 (lexicon) OST373709 (lexicon) OST364698 (lexicon)
OST364690 (lexicon) OST349123 (lexicon) OST340798 (lexicon) OST314395 (lexicon)
OST266431 (lexicon) OST191304 (lexicon) OST182456 (lexicon) OST126760 (lexicon)
OST63240 (lexicon) OST33314 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000691743 (Chr14:22335848..22339526 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGGTAACGTCTGTGTTGGA Chr14:22336060..22336079 60 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000691743 (Chr14:22335848..22339526 +)
Downstram Exon
ENSMUSE00000120693 (Chr14:22428976..22429084 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGGTAACGTCTGTGTTGGA Chr14:22336060..22336079 60 50 ACTGCCACAATCTGCACAAG Chr14:22429083..22429102 59.9 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000377733 Chr14:22319076..22319182 No primer for this exon
upstream ENSMUSE00000650586 Chr14:22320107..22320300 ATGTCGGATTCATGTCAACG Chr14:22320117..22320136 59.37 45
upstream ENSMUSE00000352161 Chr14:22335848..22336720 TGGGTAACGTCTGTGTTGGA Chr14:22336060..22336079 60 50
upstream ENSMUSE00000691743 Chr14:22335848..22339526 TGGGTAACGTCTGTGTTGGA Chr14:22336060..22336079 60 50
upstream ENSMUSE00000691747 Chr14:22336097..22336507 TCTACGCAATGTGGATTGGA Chr14:22336402..22336421 60.07 45

*** Putative Vector Insertion (Chr 14: 22339527 - 22428975) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000120693 Chr14:22428976..22429084 ACTGCCACAATCTGCACAAG Chr14:22429083..22429102 59.9 50
downstream ENSMUSE00000120710 Chr14:22438113..22438228 No primer for this exon
downstream ENSMUSE00000120702 Chr14:22438440..22438521 TTGGCATTCTGGAAAGTGGT Chr14:22438521..22438540 60.49 45
downstream ENSMUSE00000120708 Chr14:22441177..22441309 GTTTTGCATATCGCCGTTTT Chr14:22441272..22441291 59.97 40
downstream ENSMUSE00000231429 Chr14:22444055..22444437 TATTTCACCTCGGGATCTGC Chr14:22444361..22444380 60.04 50
downstream ENSMUSE00000231424 Chr14:22445941..22446062 GTCACGAGCTCCTTGTTTCC Chr14:22446016..22446035 59.85 55
downstream ENSMUSE00000231417 Chr14:22448035..22448150 CGAGGAGTACCAGGTTTGGA Chr14:22448130..22448149 60.1 55
downstream ENSMUSE00000120699 Chr14:22450544..22450685 TGAAACCATCCACACTTCTTTG Chr14:22450637..22450658 60.01 40.91
downstream ENSMUSE00000120703 Chr14:22453698..22453859 CCAACCAGATGACAGCCTTT Chr14:22453849..22453868 60.11 50
downstream ENSMUSE00000120701 Chr14:22456769..22456862 TGAGAAAGCGTCCAAATCCT Chr14:22456856..22456875 59.81 45
downstream ENSMUSE00000120698 Chr14:22479965..22480196 TGGTGGCGGTAGAGGTATTC Chr14:22480091..22480110 59.96 55
downstream ENSMUSE00000231392 Chr14:22480650..22480809 TCTCAGCTTCTCGCTCTTCC Chr14:22480807..22480826 59.97 55
downstream ENSMUSE00000231383 Chr14:22481380..22481688 TTGCAGACGATTGCCTACTG Chr14:22481473..22481492 60.01 50
downstream ENSMUSE00000231374 Chr14:22483679..22483970 AGTTGTCGAAGGGCTCATTG Chr14:22483796..22483815 60.26 50
downstream ENSMUSE00000507785 Chr14:22487553..22491354 AGGGGCTTGTATCCACACTG Chr14:22490427..22490446 59.99 55
downstream ENSMUSE00000691746 Chr14:22489967..22490095 TGTGTTCATGTAGCCGTGGT Chr14:22490053..22490072 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGGAGGATCAGGAGATGA Chr14:22414518..22414538 60.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGTCGTGACTGGGAAAACC Chr14:22351574..22351594 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021767