Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33891
Trapped Gene
D1Ertd622e (ENSMUSG00000044768)
Vector Insertion
Chr 1: 99551176 - 99558543
Public Clones IST13115A12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000401666 (Chr1:99558408..99558542 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000401666 (Chr1:99558408..99558542 -)
Downstram Exon
ENSMUSE00000358233 (Chr1:99551177..99551266 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CAAGGGAGCACAGGCATAATA Chr1:99551201..99551221 60.1 47.62

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000401666 Chr1:99558408..99558542 No primer for this exon
upstream ENSMUSE00000706939 Chr1:99558408..99558651 No primer for this exon
upstream ENSMUSE00000358233 Chr1:99551177..99551266 CCTTGGGACACTTTGGAACT Chr1:99551208..99551227 59.04 50

*** Putative Vector Insertion (Chr 1: 99551176 - 99558543) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000688610 Chr1:99540486..99542938 TTTGGTGCACTTGTCTCCTG Chr1:99542477..99542496 59.87 50
downstream ENSMUSE00000414694 Chr1:99540480..99542938 TTTGGTGCACTTGTCTCCTG Chr1:99542477..99542496 59.87 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr1:99552473..99552493 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGAGATGACCGTGACTGG Chr1:99552483..99552503 60.68 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044768