Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33898
Trapped Gene
Sall1 (ENSMUSG00000031665)
Vector Insertion
Chr 8: 91566250 - 91568062
Public Clones IST14396E3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000488541 (Chr8:91567929..91568061 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACTAAGCCGAGGACCAAGC Chr8:91567998..91568017 60.76 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000488541 (Chr8:91567929..91568061 -)
Downstram Exon
ENSMUSE00000243454 (Chr8:91566251..91566343 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACTAAGCCGAGGACCAAGC Chr8:91567998..91568017 60.76 55 AAATGTTGAGGCTTCGCTTG Chr8:91566270..91566289 60.39 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000488541 Chr8:91567929..91568061 AACTAAGCCGAGGACCAAGC Chr8:91567998..91568017 60.76 55
upstream ENSMUSE00000243454 Chr8:91566251..91566343 CAAGCGAAGCCTCAACATTT Chr8:91566292..91566311 60.39 45

*** Putative Vector Insertion (Chr 8: 91566250 - 91568062) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000211596 Chr8:91553843..91557297 GGGGTGGGAGATAGACCATT Chr8:91554464..91554483 60.01 55
downstream ENSMUSE00000243441 Chr8:91551147..91552717 CAGAGATCTCGTTGGCCTTC Chr8:91552470..91552489 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACA Chr8:91567993..91568013 60.38 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTTTAGTCCTTCGGGTGCAG Chr8:91568065..91568086 60.67 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031665