Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33908
Trapped Gene
Nat14 (ENSMUSG00000035285)
Vector Insertion
Chr 7: 4874932 - 4875504
Public Clones IST13613H2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 12% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000302501 (Chr7:4874813..4874931 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCTAACCACCTGTCAGTGC Chr7:4874865..4874884 60.57 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000302501 (Chr7:4874813..4874931 +)
Downstram Exon
ENSMUSE00000494728 (Chr7:4875505..4876608 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCTAACCACCTGTCAGTGC Chr7:4874865..4874884 60.57 60 CACGGTTTTCCGTGTCTTTT Chr7:4875535..4875554 60.01 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000637493 Chr7:4873853..4874241 GCTTAGCAACGAAGGACCAG Chr7:4874184..4874203 60.01 55
upstream ENSMUSE00000302501 Chr7:4874813..4874931 CCCTAACCACCTGTCAGTGC Chr7:4874865..4874884 60.57 60

*** Putative Vector Insertion (Chr 7: 4874932 - 4875504) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000494728 Chr7:4875505..4876608 CACGGTTTTCCGTGTCTTTT Chr7:4875535..4875554 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGCTGGAGATGCTGAAGGT Chr7:4874915..4874935 60.42 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGCTGGAGATGCTGAAGGT Chr7:4874915..4874935 60.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035285