Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33911
Trapped Gene
Azi2 (ENSMUSG00000039285)
Vector Insertion
Chr 9: 117965029 - 117968174
Public Clones IST12535D4 (tigm) IST14158D6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000327057 (Chr9:117964934..117965028 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGGCAGAGATGTCATCAGG Chr9:117964959..117964978 60.22 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000327057 (Chr9:117964934..117965028 +)
Downstram Exon
ENSMUSE00000633732 (Chr9:117968175..117968293 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGGCAGAGATGTCATCAGG Chr9:117964959..117964978 60.22 55 CTGCTTGCACTTGAGTCACC Chr9:117968254..117968273 59.62 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000633738 Chr9:117949617..117950076 CCTACGTAGCCAGGGTTCAG Chr9:117950056..117950075 59.75 60
upstream ENSMUSE00000364911 Chr9:117956531..117956751 GCGTACCCTGGAGATGAGTC Chr9:117956617..117956636 59.69 60
upstream ENSMUSE00000327094 Chr9:117958428..117958553 GCATATCGTGAGGTTTGCATT Chr9:117958497..117958517 59.98 42.86
upstream ENSMUSE00000327081 Chr9:117959015..117959114 No primer for this exon
upstream ENSMUSE00000327068 Chr9:117960472..117960620 TTTAAACCCACCCTCATCCA Chr9:117960482..117960501 60.16 45
upstream ENSMUSE00000327057 Chr9:117964934..117965028 AGGGCAGAGATGTCATCAGG Chr9:117964959..117964978 60.22 55

*** Putative Vector Insertion (Chr 9: 117965029 - 117968174) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000633732 Chr9:117968175..117968293 CTGCTTGCACTTGAGTCACC Chr9:117968254..117968273 59.62 55
downstream ENSMUSE00000382301 Chr9:117970832..117973025 GAGAACTGCACAAGCCATCA Chr9:117971347..117971366 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCACAGGTCTCCTGAGTTCC Chr9:117968024..117968044 59.68 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCACAGGTCTCCTGAGTTCC Chr9:117968024..117968044 59.68 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039285