Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33912
Trapped Gene
Rpl24 (ENSMUSG00000022601)
Vector Insertion
Chr 16: 55971548 - 55980707
Public Clones PST18689-NR (escells) IST14356E12 (tigm) IST10887D7 (tigm) IST11868A5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000222998 (Chr16:55971424..55971547 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGGGAAACGCTAGTGTGGT Chr16:55971491..55971510 60.03 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000222998 (Chr16:55971424..55971547 +)
Downstram Exon
ENSMUSE00000713691 (Chr16:55980708..55980834 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGGGAAACGCTAGTGTGGT Chr16:55971491..55971510 60.03 55 TTTCCGAAGCATCCGATATT Chr16:55980803..55980822 59.51 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718751 Chr16:55966456..55966551 TCTCTTCGCCATCTTTACCC Chr16:55966505..55966524 59.27 50
upstream ENSMUSE00000699413 Chr16:55966501..55966551 TCTCTTCGCCATCTTTACCC Chr16:55966505..55966524 59.27 50
upstream ENSMUSE00000364485 Chr16:55966506..55966551 AGGCCGACATCTATCACCAT Chr16:55966529..55966548 59.39 50
upstream ENSMUSE00000223023 Chr16:55966660..55966735 GCAGTTTCAGCGGGTACAAG Chr16:55966671..55966690 60.83 55
upstream ENSMUSE00000128658 Chr16:55967173..55967283 AAAAGGAATCCTCGGCAGAT Chr16:55967218..55967237 60.04 45
upstream ENSMUSE00000128665 Chr16:55969623..55969759 AAATTCCAACGAGCCATCAC Chr16:55969659..55969678 59.94 45
upstream ENSMUSE00000128661 Chr16:55970225..55970288 AAAAGGCTAAGCAGGCATCA Chr16:55970242..55970261 59.98 45
upstream ENSMUSE00000222998 Chr16:55971424..55971547 GTGGGAAACGCTAGTGTGGT Chr16:55971491..55971510 60.03 55

*** Putative Vector Insertion (Chr 16: 55971548 - 55980707) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000713691 Chr16:55980708..55980834 TTTCCGAAGCATCCGATATT Chr16:55980803..55980822 59.51 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCATCACAGAAGTCAGGTGT Chr16:55980500..55980521 60.02 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCAGGTGTGCAATTTTGTGA Chr16:55977512..55977533 59.61 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022601