Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33913
Trapped Gene
Maml1 (ENSMUSG00000050567)
Vector Insertion
Chr 11: 50069138 - 50074576
Public Clones IST12788H6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 59% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000296691 (Chr11:50074479..50074575 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAAAGCACCTTCCCACAAC Chr11:50074497..50074516 60.01 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000296691 (Chr11:50074479..50074575 -)
Downstram Exon
ENSMUSE00000359511 (Chr11:50069139..50072330 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAAAGCACCTTCCCACAAC Chr11:50074497..50074516 60.01 50 AGGCAGGGTTCCCTTACTGT Chr11:50071926..50071945 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000717356 Chr11:50105228..50105818 GTATAGCGGACAGGCCGAAG Chr11:50105764..50105783 62.02 60
upstream ENSMUSE00000718647 Chr11:50105228..50105818 GTATAGCGGACAGGCCGAAG Chr11:50105764..50105783 62.02 60
upstream ENSMUSE00000409149 Chr11:50079097..50080512 GCCCTCACGAGTGTGGTATT Chr11:50079683..50079702 60 55
upstream ENSMUSE00000679176 Chr11:50079097..50080512 GCCCTCACGAGTGTGGTATT Chr11:50079683..50079702 60 55
upstream ENSMUSE00000459430 Chr11:50076752..50076985 AACAGCTCGCCATACCTCAG Chr11:50076882..50076901 60.42 55
upstream ENSMUSE00000296691 Chr11:50074479..50074575 ACAAAGCACCTTCCCACAAC Chr11:50074497..50074516 60.01 50
upstream ENSMUSE00000359511 Chr11:50069139..50072330 ACAAGTCCCAAGGGTGTCAG Chr11:50071911..50071930 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr11:50071506..50071526 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGCCTGGCTTAAGTCCTTCG Chr11:50071598..50071619 63.78 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000050567