Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33923
Trapped Gene
Adarb2 (ENSMUSG00000052551)
Vector Insertion
Chr 13: 8569821 - 8671650
Public Clones IST15043B5 (tigm) IST14331G5 (tigm) IST13523E12 (tigm) IST12781H8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000465454 (Chr13:8568913..8569820 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAACCGAAATGTGAGCAACC Chr13:8568938..8568957 59.98 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000465454 (Chr13:8568913..8569820 +)
Downstram Exon
ENSMUSE00000476554 (Chr13:8671651..8671765 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAACCGAAATGTGAGCAACC Chr13:8568938..8568957 59.98 45 GACGATTCCTGCCAGTGTTT Chr13:8671758..8671777 60.12 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000471563 Chr13:8202467..8202566 AGAGGGTCTGGAGGGCTAAG Chr13:8202491..8202510 59.83 60
upstream ENSMUSE00000468343 Chr13:8558350..8558436 TGTCAACCTTCCTTGCTCCT Chr13:8558365..8558384 59.84 50
upstream ENSMUSE00000465454 Chr13:8568913..8569820 AAACCGAAATGTGAGCAACC Chr13:8568938..8568957 59.98 45

*** Putative Vector Insertion (Chr 13: 8569821 - 8671650) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000476554 Chr13:8671651..8671765 GACGATTCCTGCCAGTGTTT Chr13:8671758..8671777 60.12 50
downstream ENSMUSE00000441669 Chr13:8696866..8697034 CCACGATCTCAGCATGACAG Chr13:8696985..8697004 60.43 55
downstream ENSMUSE00000441655 Chr13:8700826..8700977 TTTCTCGCAGCCTGTAACCT Chr13:8700899..8700918 60.01 50
downstream ENSMUSE00000441646 Chr13:8712846..8713014 CTGACGATGTGTTTGCTGCT Chr13:8712873..8712892 60.06 50
downstream ENSMUSE00000441662 Chr13:8731036..8731217 AGGCCTGTTTTGTCGGTATG Chr13:8731210..8731229 59.99 50
downstream ENSMUSE00000455934 Chr13:8751819..8751997 TGAAGTGGGGAGACTTTCCT Chr13:8751869..8751888 58.72 50
downstream ENSMUSE00000684878 Chr13:8756472..8759554 GCATAGGCCAAAGTGATGGT Chr13:8758877..8758896 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr13:8668871..8668891 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGGCATTTTGTTTCCAGTC Chr13:8632795..8632815 59.03 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052551