Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33927
Trapped Gene
1110033M05Rik (ENSMUSG00000064138)
Vector Insertion
Chr 13: 77848115 - 77898688
Public Clones (sanger) IST10616F10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000717096 (Chr13:77847983..77848114 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCGGATCTTGAGAGAGAAA Chr13:77847998..77848017 60.62 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000717096 (Chr13:77847983..77848114 +)
Downstram Exon
ENSMUSE00000641045 (Chr13:77898689..77898790 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCGGATCTTGAGAGAGAAA Chr13:77847998..77848017 60.62 50 AGGTGGTTCGTCCTTTTTCA Chr13:77898744..77898763 59.57 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000709178 Chr13:77847983..77848114 CGCGGATCTTGAGAGAGAAA Chr13:77847998..77848017 60.62 50
upstream ENSMUSE00000717096 Chr13:77847983..77848114 CGCGGATCTTGAGAGAGAAA Chr13:77847998..77848017 60.62 50

*** Putative Vector Insertion (Chr 13: 77848115 - 77898688) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000327844 Chr13:77898689..77898790 AGGTGGTTCGTCCTTTTTCA Chr13:77898744..77898763 59.57 45
downstream ENSMUSE00000641045 Chr13:77898689..77898790 AGGTGGTTCGTCCTTTTTCA Chr13:77898744..77898763 59.57 45
downstream ENSMUSE00000327838 Chr13:77901099..77901199 CTCGCCCAGAGCTTCATATC Chr13:77901202..77901221 59.94 55
downstream ENSMUSE00000453983 Chr13:77964584..77964649 No primer for this exon
downstream ENSMUSE00000327822 Chr13:77973771..77973962 CTGCCCTGACAACACCACTA Chr13:77973885..77973904 59.74 55
downstream ENSMUSE00000563997 Chr13:77976493..77976552 GATTGCAGGGCCATCTACTT Chr13:77976549..77976568 59.15 50
downstream ENSMUSE00000501965 Chr13:78041915..78042136 TTTGAGGGTTGCGGTACTTC Chr13:78042107..78042126 60.11 50
downstream ENSMUSE00000496125 Chr13:78091246..78091365 CATAGACCGCATGCTCTTCA Chr13:78091282..78091301 59.97 50
downstream ENSMUSE00000476708 Chr13:78138847..78138963 AGTCTGTCAATGCCACAGCA Chr13:78138907..78138926 60.47 50
downstream ENSMUSE00000570078 Chr13:78145649..78145733 ACAGTCAGGCAGCATGGATT Chr13:78145720..78145739 60.69 50
downstream ENSMUSE00000641044 Chr13:78302774..78305491 CCCTGCATAGGTTTTTCCAA Chr13:78304683..78304702 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGGACAGAGCTCAGGTAG Chr13:77878100..77878120 60.4 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCATGTGGTCAAGGCACAAC Chr13:77887081..77887101 60.58 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000064138