Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33930
Trapped Gene
Hist2h3c1 (ENSMUSG00000070392)
Vector Insertion
Chr 3: 96049476 - 96051220
Public Clones IST10102B1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000588451 (Chr3:96049477..96052431 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTTCGAGGACACCAACCTGT Chr3:96051120..96051139 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000588451 (Chr3:96049477..96052431 +)
Downstram Exon
ENSMUSE00000571527 (Chr3:96050674..96051219 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTTCGAGGACACCAACCTGT Chr3:96051120..96051139 60.01 55 GAAGACGGAAGACACCCAAA Chr3:96050808..96050827 60.09 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC

*** Putative Vector Insertion (Chr 3: 96049476 - 96051220) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000588451 Chr3:96049477..96052431 AGCTCGGTCGACTTCTGGTA Chr3:96050993..96051012 60.01 55
downstream ENSMUSE00000571527 Chr3:96050674..96051219 GAAGACGGAAGACACCCAAA Chr3:96050808..96050827 60.09 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCAAGTAATCGCCTTGCAG Chr3:96049521..96049541 60.54 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTACCGTTTCCTGGTTGTGG Chr3:96049460..96049480 60.27 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070392