Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33950
Trapped Gene
Synpr (ENSMUSG00000056296)
Vector Insertion
Chr 14: 14395631 - 14441083
Public Clones IST14790E6 (tigm) IST14367E8 (tigm) IST14185G10 (tigm) IST13652C8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000453636 (Chr14:14395432..14395630 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGTGAGGGAAAGGAACAGC Chr14:14395462..14395481 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000453636 (Chr14:14395432..14395630 +)
Downstram Exon
ENSMUSE00000453632 (Chr14:14441084..14441275 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGTGAGGGAAAGGAACAGC Chr14:14395462..14395481 59.84 55 CACTTGTTGGAAGGCTGCTT Chr14:14441232..14441251 60.43 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000650916 Chr14:14117294..14117516 CTGAAGGGAACTGGTTCGAG Chr14:14117456..14117475 59.84 55
upstream ENSMUSE00000475796 Chr14:14117655..14117720 No primer for this exon
upstream ENSMUSE00000692579 Chr14:14286571..14286866 GCATCTGACTTTCCCTCTGC Chr14:14286682..14286701 59.96 55
upstream ENSMUSE00000454305 Chr14:14326022..14326146 TGACATAGCGTTTGCGTACC Chr14:14326120..14326139 59.76 50
upstream ENSMUSE00000453636 Chr14:14395432..14395630 CTGTGAGGGAAAGGAACAGC Chr14:14395462..14395481 59.84 55

*** Putative Vector Insertion (Chr 14: 14395631 - 14441083) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000453632 Chr14:14441084..14441275 CACTTGTTGGAAGGCTGCTT Chr14:14441232..14441251 60.43 50
downstream ENSMUSE00000472199 Chr14:14446238..14447973 CCCACCACTTGACCCATAAC Chr14:14446411..14446430 60.09 55
downstream ENSMUSE00000692578 Chr14:14446238..14447868 CCCACCACTTGACCCATAAC Chr14:14446411..14446430 60.09 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAACCAAAACCCAAAGAAA Chr14:14437658..14437679 59.84 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGAACCAAAACCCAAAGAAA Chr14:14437658..14437679 59.84 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056296