Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33988
Trapped Gene
Tpte (ENSMUSG00000031481)
Vector Insertion
Chr 8: 23447032 - 23455456
Public Clones IST13335H11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000209871 (Chr8:23446967..23447031 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATTTCCATCGTCTGGAAGG Chr8:23446985..23447004 60.45 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000209871 (Chr8:23446967..23447031 +)
Downstram Exon
ENSMUSE00000209873 (Chr8:23455457..23455517 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATTTCCATCGTCTGGAAGG Chr8:23446985..23447004 60.45 50 ATAGTGGTTTGGGTGCTTGG Chr8:23455501..23455520 59.85 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000424745 Chr8:23393913..23394252 CAGGGTCTTACTGGGGCTTT Chr8:23394184..23394203 60.49 55
upstream ENSMUSE00000489735 Chr8:23395351..23395446 GCCATTTGTATCTCTGGATGG Chr8:23395407..23395427 59.4 47.62
upstream ENSMUSE00000490643 Chr8:23407638..23407691 TTCTCAGCCCTCCAGAAAAA Chr8:23407662..23407681 59.93 45
upstream ENSMUSE00000424714 Chr8:23407721..23407753 No primer for this exon
upstream ENSMUSE00000637837 Chr8:23407755..23407777 No primer for this exon
upstream ENSMUSE00000424713 Chr8:23413274..23413330 No primer for this exon
upstream ENSMUSE00000424710 Chr8:23414441..23414485 No primer for this exon
upstream ENSMUSE00000424704 Chr8:23416310..23416366 TTATGCGGACCCCATCAGTA Chr8:23416343..23416362 61.25 50
upstream ENSMUSE00000424694 Chr8:23417408..23417458 No primer for this exon
upstream ENSMUSE00000424691 Chr8:23421752..23421799 No primer for this exon
upstream ENSMUSE00000424686 Chr8:23425523..23425576 ACCCAGGGAGAATCTGCTTT Chr8:23425527..23425546 60.07 50
upstream ENSMUSE00000424678 Chr8:23426751..23426801 TCCCAAGTACACTGCAAACG Chr8:23426756..23426775 59.76 50
upstream ENSMUSE00000424671 Chr8:23428799..23428849 ACCAGGAAGAGCAAATGAACA Chr8:23428825..23428845 59.73 42.86
upstream ENSMUSE00000424665 Chr8:23431328..23431393 CGACGATGATGAACGTACTGA Chr8:23431355..23431375 59.73 47.62
upstream ENSMUSE00000424660 Chr8:23435968..23436018 AGAAATTTGTGCGCATCCTT Chr8:23435979..23435998 59.71 40
upstream ENSMUSE00000391574 Chr8:23438116..23438277 TTTCCTGGTCATTCTGGATGT Chr8:23438128..23438148 59.4 42.86
upstream ENSMUSE00000259895 Chr8:23443637..23443756 GACGGCGCTATTTCTCTGAC Chr8:23443639..23443658 59.99 55
upstream ENSMUSE00000209870 Chr8:23445831..23445930 TTACTGCGGCCTCTACGACT Chr8:23445841..23445860 60.04 55
upstream ENSMUSE00000209879 Chr8:23446085..23446148 AAGCGACGCTACAAGAAGGA Chr8:23446097..23446116 60.15 50
upstream ENSMUSE00000209871 Chr8:23446967..23447031 CATTTCCATCGTCTGGAAGG Chr8:23446985..23447004 60.45 50

*** Putative Vector Insertion (Chr 8: 23447032 - 23455456) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000209873 Chr8:23455457..23455517 ATAGTGGTTTGGGTGCTTGG Chr8:23455501..23455520 59.85 50
downstream ENSMUSE00000209885 Chr8:23456291..23456372 ATGATTCTGCGGACCCTGTA Chr8:23456345..23456364 60.48 50
downstream ENSMUSE00000209881 Chr8:23456493..23456581 CCTTACAGTGAATCGCGACA Chr8:23456575..23456594 59.86 50
downstream ENSMUSE00000209886 Chr8:23459798..23459859 CACACACCATGGTTCCAGTT Chr8:23459824..23459843 59.28 50
downstream ENSMUSE00000424614 Chr8:23461915..23461995 GGAACTTCGAGCTGTTGCTT Chr8:23461975..23461994 59.62 50
downstream ENSMUSE00000397369 Chr8:23465938..23466043 TGGGAGGGAGAGTTAGTTGGT Chr8:23466000..23466020 59.98 52.38
downstream ENSMUSE00000259832 Chr8:23469867..23469958 AAAAACAGTCTCCTGCCACATT Chr8:23469932..23469953 60.04 40.91
downstream ENSMUSE00000424596 Chr8:23471551..23471598 AGATGTGGGCAAACAAAGGT Chr8:23471573..23471592 59.45 45
downstream ENSMUSE00000209888 Chr8:23476386..23476478 ATCGTATAGAGCCGGGCAAT Chr8:23476454..23476473 60.81 50
downstream ENSMUSE00000209887 Chr8:23479983..23480053 AGAAAAAGGGGCAGTCATCA Chr8:23480022..23480041 59.67 45
downstream ENSMUSE00000346766 Chr8:23481611..23481890 AGCGGCACTTACTCAACAGC Chr8:23481735..23481754 60.6 55
downstream ENSMUSE00000706582 Chr8:23481611..23481713 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTAAGGCTATCCCCACAGC Chr8:23453032..23453052 60.85 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTAAGGCTATCCCCACAGC Chr8:23453032..23453052 60.85 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031481