Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI33995
Trapped Gene
Sema4a (ENSMUSG00000028064)
Vector Insertion
Chr 3: 88239887 - 88241823
Public Clones IST14885E8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000175624 (Chr3:88241725..88241822 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTGGAAGCAGGACATGGAA Chr3:88241801..88241820 61.18 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000175624 (Chr3:88241725..88241822 -)
Downstram Exon
ENSMUSE00000673472 (Chr3:88239888..88241174 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTGGAAGCAGGACATGGAA Chr3:88241801..88241820 61.18 50 GCATCTACGTCACTGGCAGA Chr3:88240594..88240613 60.02 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000375428 Chr3:88259470..88259674 TTCAGGGTTTGAACACAGGAC Chr3:88259493..88259513 60 47.62
upstream ENSMUSE00000673465 Chr3:88259466..88259619 TTCAGGGTTTGAACACAGGAC Chr3:88259493..88259513 60 47.62
upstream ENSMUSE00000175633 Chr3:88258601..88258768 ATGGAGTCTCCTGCGTGTTT Chr3:88258691..88258710 59.73 50
upstream ENSMUSE00000175628 Chr3:88256893..88257053 ACAAAAAGGCCTCCGAGACT Chr3:88257003..88257022 60.25 50
upstream ENSMUSE00000673464 Chr3:88256893..88257053 ACAAAAAGGCCTCCGAGACT Chr3:88257003..88257022 60.25 50
upstream ENSMUSE00000175627 Chr3:88255942..88256004 GCCAGCCAGTGAGAGAAAAA Chr3:88255977..88255996 60.52 50
upstream ENSMUSE00000175622 Chr3:88255610..88255708 TCTATGCCTGTGGGACCTTT Chr3:88255637..88255656 59.55 50
upstream ENSMUSE00000673506 Chr3:88255307..88255372 TCCAAGATTCCCTCCTGTTG Chr3:88255349..88255368 60.04 50
upstream ENSMUSE00000673505 Chr3:88255279..88255305 TTGACCCTGTTCACAAGCAC Chr3:88255283..88255302 59.73 50
upstream ENSMUSE00000175635 Chr3:88255267..88255372 TCCAAGATTCCCTCCTGTTG Chr3:88255349..88255368 60.04 50
upstream ENSMUSE00000175631 Chr3:88254433..88254549 GATCCCAGCCTGTTCTCAAG Chr3:88254461..88254480 59.8 55
upstream ENSMUSE00000673503 Chr3:88254433..88254562 CCTGGTCTTAGATGGGATGC Chr3:88254541..88254560 59.51 55
upstream ENSMUSE00000175630 Chr3:88253910..88254034 GCCAGCGAGTTTGACTTCTT Chr3:88253950..88253969 59.62 50
upstream ENSMUSE00000175636 Chr3:88253602..88253774 CCTCTGTTTCCCGCATCTAC Chr3:88253622..88253641 59.69 55
upstream ENSMUSE00000175634 Chr3:88251913..88252063 ACGGACATTGAGCGAGTCTT Chr3:88251998..88252017 59.87 50
upstream ENSMUSE00000175626 Chr3:88244620..88244800 TGAGCACGTGGTAGGAACAC Chr3:88244719..88244738 59.75 55
upstream ENSMUSE00000175623 Chr3:88242365..88242483 CTCTGAGCCTGTTCGAAACC Chr3:88242385..88242404 59.99 55
upstream ENSMUSE00000175629 Chr3:88242105..88242262 GCCAATTGCAGTGTCTACGA Chr3:88242195..88242214 59.87 50
upstream ENSMUSE00000175624 Chr3:88241725..88241822 CTTGGAAGCAGGACATGGAA Chr3:88241801..88241820 61.18 50
upstream ENSMUSE00000673472 Chr3:88239888..88241174 TCTGCCAGTGACGTAGATGC Chr3:88240616..88240635 60.02 55

*** Putative Vector Insertion (Chr 3: 88239887 - 88241823) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000175625 Chr3:88239884..88241174 GCATCTACGTCACTGGCAGA Chr3:88240594..88240613 60.02 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAGAGCTGAGTTTGCTTGCT Chr3:88241833..88241854 59.95 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAGAGCTGAGTTTGCTTGCT Chr3:88241833..88241854 59.95 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028064