Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34001
Trapped Gene
4931440B09Rik (ENSMUSG00000024114)
Vector Insertion
Chr 17: 23974457 - 23979493
Public Clones IST14779A12 (tigm) IST14813G11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000482305 (Chr17:23979212..23979492 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGACGGTACAGGGTAAAGG Chr17:23979392..23979411 59.85 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000482305 (Chr17:23979212..23979492 -)
Downstram Exon
ENSMUSE00000138460 (Chr17:23974458..23974615 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGACGGTACAGGGTAAAGG Chr17:23979392..23979411 59.85 55 TCCTTGGTGATCAAGTGGTG Chr17:23974482..23974501 59.52 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000454079 Chr17:23981044..23981123 No primer for this exon
upstream ENSMUSE00000313232 Chr17:23980924..23980950 No primer for this exon
upstream ENSMUSE00000313208 Chr17:23980806..23980838 No primer for this exon
upstream ENSMUSE00000311964 Chr17:23980409..23980577 GGATAGTGGGCGGGATAGAA Chr17:23980525..23980544 61.17 55
upstream ENSMUSE00000482305 Chr17:23979212..23979492 TGGACGGTACAGGGTAAAGG Chr17:23979392..23979411 59.85 55
upstream ENSMUSE00000138460 Chr17:23974458..23974615 CCAGGAGCTGTTCGAGATTT Chr17:23974532..23974551 59.43 50

*** Putative Vector Insertion (Chr 17: 23974457 - 23979493) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000347707 Chr17:23973753..23974115 CCTGGTGAAGCAAGCTATCC Chr17:23973776..23973795 59.84 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCTCCTGAGGGTCCTGAT Chr17:23979512..23979532 60.47 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCTCCTGAGGGTCCTGAT Chr17:23979512..23979532 60.47 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024114