Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34006
Trapped Gene
Gm1673 (ENSMUSG00000070858)
Vector Insertion
Chr 5: 34326790 - 34327546
Public Clones IST12413A4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000600743 (Chr5:34326701..34326789 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTACGGAAAACCGCCTACAG Chr5:34326757..34326776 59.76 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000600743 (Chr5:34326701..34326789 +)
Downstram Exon
ENSMUSE00000600742 (Chr5:34327547..34327657 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTACGGAAAACCGCCTACAG Chr5:34326757..34326776 59.76 55 CAAGGAATATCACTGGCCAAA Chr5:34327640..34327660 59.95 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699150 Chr5:34326086..34326545 CTGTCGCCACGGACTTTACT Chr5:34326452..34326471 60.31 55
upstream ENSMUSE00000699146 Chr5:34326119..34326288 No primer for this exon
upstream ENSMUSE00000654236 Chr5:34326140..34326213 No primer for this exon
upstream ENSMUSE00000699140 Chr5:34326183..34326292 No primer for this exon
upstream ENSMUSE00000654233 Chr5:34326406..34326545 CTGTCGCCACGGACTTTACT Chr5:34326452..34326471 60.31 55
upstream ENSMUSE00000699144 Chr5:34326406..34326545 CTGTCGCCACGGACTTTACT Chr5:34326452..34326471 60.31 55
upstream ENSMUSE00000600743 Chr5:34326701..34326789 CTACGGAAAACCGCCTACAG Chr5:34326757..34326776 59.76 55

*** Putative Vector Insertion (Chr 5: 34326790 - 34327546) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000600742 Chr5:34327547..34327657 CAAGGAATATCACTGGCCAAA Chr5:34327640..34327660 59.95 42.86
downstream ENSMUSE00000699149 Chr5:34327547..34327658 CAAGGAATATCACTGGCCAAA Chr5:34327640..34327660 59.95 42.86

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTACGGAAAACCGCCTACAG Chr5:34326758..34326778 59.76 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTACGGAAAACCGCCTACAG Chr5:34326758..34326778 59.76 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000070858