Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3402
Trapped Gene
Spc24 (ENSMUSG00000074476)
Vector Insertion
Chr 9: 21562274 - 21564562
Public Clones AG0164 (sanger) CMHD-GT_271A1-3 (cmhd) CMHD-GT_271G1-3 (cmhd) IST10895D6 (tigm)
Private Clones OST373151 (lexicon) OST305009 (lexicon) OST297612 (lexicon) OST291775 (lexicon)
OST183109 (lexicon) OST33989 (lexicon)
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000638264 (Chr9:21564563..21564733 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAGCTACGAGCAGATGAT Chr9:21564610..21564629 59.42 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000638264 (Chr9:21564563..21564733 -)
Downstram Exon
ENSMUSE00000638262 (Chr9:21562129..21562273 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAGCTACGAGCAGATGAT Chr9:21564610..21564629 59.42 55 GGCGCGTACATTCTTTCAGT Chr9:21562189..21562208 60.28 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000638264 Chr9:21564563..21564733 GGGAGCTACGAGCAGATGAT Chr9:21564610..21564629 59.42 55

*** Putative Vector Insertion (Chr 9: 21562274 - 21564562) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000638262 Chr9:21562129..21562273 GGCGCGTACATTCTTTCAGT Chr9:21562189..21562208 60.28 50
downstream ENSMUSE00000638259 Chr9:21561734..21561838 TCCTGCAGCTCTGTGATGAG Chr9:21561793..21561812 60.29 55
downstream ENSMUSE00000638257 Chr9:21561561..21561637 CCTGGCTCGCATTCATAATC Chr9:21561553..21561572 60.57 50
downstream ENSMUSE00000702626 Chr9:21560547..21560739 GTGCACTGTCCAAGTGGATG Chr9:21560670..21560689 60.16 55
downstream ENSMUSE00000702627 Chr9:21560547..21560739 GTGCACTGTCCAAGTGGATG Chr9:21560670..21560689 60.16 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTAATCGCCTTGCAGCAC Chr9:21564494..21564514 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTAATCGCCTTGCAGCACAT Chr9:21564664..21564684 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 3 AACTGCGTGACTGGGAAAAC Chr9:21564668..21564688 60.16 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074476