Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34023
Trapped Gene
Aff2 (ENSMUSG00000031189)
Vector Insertion
Chr X: 66798445 - 66947118
Public Clones IST14103F12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000430149 (ChrX:66797584..66798444 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTCCACCTTCAGTCGTGAT ChrX:66797812..66797831 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000430149 (ChrX:66797584..66798444 +)
Downstram Exon
ENSMUSE00000430146 (ChrX:66947119..66947163 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTCCACCTTCAGTCGTGAT ChrX:66797812..66797831 60.11 55 AACACAGCTTGGATCACTGG ChrX:66947151..66947170 58.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000655492 ChrX:66613506..66614013 TCGACTTTTTCAGGGATTGG ChrX:66613977..66613996 60.04 45
upstream ENSMUSE00000430566 ChrX:66776611..66776743 GAATGGGAACGAAGGAATCA ChrX:66776648..66776667 59.87 45
upstream ENSMUSE00000430149 ChrX:66797584..66798444 CCTCCACCTTCAGTCGTGAT ChrX:66797812..66797831 60.11 55

*** Putative Vector Insertion (Chr X: 66798445 - 66947118) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000430146 ChrX:66947119..66947163 AACACAGCTTGGATCACTGG ChrX:66947151..66947170 58.72 50
downstream ENSMUSE00000430141 ChrX:66978217..66978253 CCTGGAGTCAGATGCTGAGAT ChrX:66978241..66978261 59.42 52.38
downstream ENSMUSE00000430140 ChrX:66978588..66978621 TTTGTGGAAGCTCTGCTGCT ChrX:66978624..66978643 61.26 50
downstream ENSMUSE00000430137 ChrX:67020357..67020453 GTGCACTGTGTGGTCAAGGT ChrX:67020437..67020456 59.63 55
downstream ENSMUSE00000430133 ChrX:67038237..67038274 GGTTTTGCCTTTTCAACAGC ChrX:67038259..67038278 59.73 45
downstream ENSMUSE00000430130 ChrX:67083919..67084078 GTTTGTGTTGCAGGCGTAGA ChrX:67083963..67083982 59.91 50
downstream ENSMUSE00000430128 ChrX:67087237..67088226 GTAGCTTTGTTTCGGCTTCG ChrX:67087703..67087722 60.02 50
downstream ENSMUSE00000430123 ChrX:67093651..67093772 TCTAGTGCTGGGAGGCTTGT ChrX:67093773..67093792 60.01 55
downstream ENSMUSE00000430119 ChrX:67097096..67097315 ACTGACATTTCTGCGACGTG ChrX:67097198..67097217 59.9 50
downstream ENSMUSE00000430113 ChrX:67102071..67102372 CTCCGGACATTGGCACTACT ChrX:67102351..67102370 60.13 55
downstream ENSMUSE00000372956 ChrX:67102945..67103008 GTGCATCAGCTTTGTGTTTCA ChrX:67103008..67103028 59.9 42.86
downstream ENSMUSE00000307639 ChrX:67106253..67106389 ACTTCGCTTCCAGAGGATCA ChrX:67106352..67106371 59.95 50
downstream ENSMUSE00000307632 ChrX:67109865..67109936 GGGCTTGCAAAGTTCTTCAG ChrX:67109900..67109919 59.99 50
downstream ENSMUSE00000307625 ChrX:67110305..67110398 No primer for this exon
downstream ENSMUSE00000307616 ChrX:67112651..67112703 CATTGCCTACCCAAGGAGAT ChrX:67112702..67112721 59.01 50
downstream ENSMUSE00000307606 ChrX:67117095..67117285 TAGCCCCGAAGCACATTACT ChrX:67117244..67117263 59.73 50
downstream ENSMUSE00000623742 ChrX:67120885..67121212 ACAGTCCCTGGCGAACATAG ChrX:67120977..67120996 60.13 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTTCATGAGTTTTGTGCAAG ChrX:66852443..66852464 58.27 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACAATCCTGCAAACAAGTG ChrX:66855423..66855444 59.75 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031189