Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34031
Trapped Gene
Snap25 (ENSMUSG00000027273)
Vector Insertion
Chr 2: 136539337 - 136581803
Public Clones IST14549B1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000706206 (Chr2:136539298..136539336 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCCTCCGGAGAAGACAAG Chr2:136539317..136539336 59.8 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000706206 (Chr2:136539298..136539336 +)
Downstram Exon
ENSMUSE00000290499 (Chr2:136581804..136581937 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCCTCCGGAGAAGACAAG Chr2:136539317..136539336 59.8 55 CAGCAAGTCAGTGGTGCTTC Chr2:136581836..136581855 59.62 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000706206 Chr2:136539298..136539336 CATCCTCCGGAGAAGACAAG Chr2:136539317..136539336 59.8 55

*** Putative Vector Insertion (Chr 2: 136539337 - 136581803) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000290499 Chr2:136581804..136581937 CAGCAAGTCAGTGGTGCTTC Chr2:136581836..136581855 59.62 55
downstream ENSMUSE00000167774 Chr2:136584047..136584088 No primer for this exon
downstream ENSMUSE00000167770 Chr2:136589309..136589357 GTCCTGATGCCAGCATCTTT Chr2:136589334..136589353 60.23 50
downstream ENSMUSE00000682755 Chr2:136595479..136595596 AATTTTTCTCGGCCTCCTTC Chr2:136595550..136595569 59.67 45
downstream ENSMUSE00000167772 Chr2:136595793..136595910 CTTCCTCAATGCGTTCCAGT Chr2:136595819..136595838 60.26 50
downstream ENSMUSE00000167776 Chr2:136599631..136599756 ATTATTGCCCCAGGCTTTTT Chr2:136599676..136599695 59.81 40
downstream ENSMUSE00000404871 Chr2:136603072..136603216 GCGATTCTGGGTGTCAATCT Chr2:136603195..136603214 60.08 50
downstream ENSMUSE00000706204 Chr2:136606811..136608090 CAATGGGGGTGACTGACTCT Chr2:136607046..136607065 59.96 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTTTGGTAATCGCCTTGC Chr2:136560380..136560400 59.19 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAATCGTGACTGGGAAAACC Chr2:136560384..136560404 58.89 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027273