Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34036
Trapped Gene
Fank1 (ENSMUSG00000053111)
Vector Insertion
Chr 7: 140968654 - 141044848
Public Clones IST10185B3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000434201 (Chr7:140968544..140968653 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGACGAAGACAGGCGTTAGG Chr7:140968571..140968590 59.5 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000434201 (Chr7:140968544..140968653 +)
Downstram Exon
ENSMUSE00000434184 (Chr7:141044849..141045026 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGACGAAGACAGGCGTTAGG Chr7:140968571..140968590 59.5 55 TCCTCAATGGAGAACCGAAG Chr7:141044990..141045009 60.19 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000434201 Chr7:140968544..140968653 AGACGAAGACAGGCGTTAGG Chr7:140968571..140968590 59.5 55
upstream ENSMUSE00000720162 Chr7:140968625..140968653 No primer for this exon

*** Putative Vector Insertion (Chr 7: 140968654 - 141044848) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000434184 Chr7:141044849..141045026 TCCTCAATGGAGAACCGAAG Chr7:141044990..141045009 60.19 50
downstream ENSMUSE00000434183 Chr7:141053786..141053910 ACCACATGCCTTGTTGCATA Chr7:141053812..141053831 59.99 45
downstream ENSMUSE00000434178 Chr7:141059801..141059882 TCACACTGACAGCACGATGA Chr7:141059848..141059867 60.03 50
downstream ENSMUSE00000434175 Chr7:141060961..141061035 ATGAGAGCGGTAAAGCCAAA Chr7:141061011..141061030 59.85 45
downstream ENSMUSE00000434171 Chr7:141061705..141061770 GCCACTTCCGTTCTTCAGAT Chr7:141061765..141061784 59.29 50
downstream ENSMUSE00000434166 Chr7:141068431..141068596 CGTGTCTCCGGAGGTATTTG Chr7:141068492..141068511 60.51 55
downstream ENSMUSE00000434159 Chr7:141071562..141071705 GAGGCGTCTTTCCATCTTTG Chr7:141071703..141071722 59.81 50
downstream ENSMUSE00000434153 Chr7:141071955..141072032 CAGTTGCATCTGCCCCTTTA Chr7:141072024..141072043 61.16 50
downstream ENSMUSE00000434148 Chr7:141072127..141072171 TGGCCATTTCTAGGACACCT Chr7:141072157..141072176 59.55 50
downstream ENSMUSE00000434192 Chr7:141072281..141073206 TGGGAAGAGTTGCCCATTAC Chr7:141072500..141072519 59.93 50
downstream ENSMUSE00000711767 Chr7:141072281..141072548 CAGAGGACTTCCTTGGCATC Chr7:141072338..141072357 59.8 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGAAAGGCTGGGTAGACA Chr7:140983623..140983643 60.25 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGAAAGGCTGGGTAGACA Chr7:140983623..140983643 60.25 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053111