Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34046
Trapped Gene
Psmb10 (ENSMUSG00000031897)
Vector Insertion
Chr 8: 108461140 - 108461492
Public Clones IST14243D4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214461 (Chr8:108461394..108461491 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAAAGCTGCGAGAAGATCCA Chr8:108461415..108461434 60.1 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214461 (Chr8:108461394..108461491 -)
Downstram Exon
ENSMUSE00000214457 (Chr8:108461141..108461281 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAAAGCTGCGAGAAGATCCA Chr8:108461415..108461434 60.1 45 TCCGCGTAGTCATCTCAGTG Chr8:108461213..108461232 60.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000386255 Chr8:108461855..108461987 CAGGAGGCTTCTCTTTCGAG Chr8:108461866..108461885 59.3 55
upstream ENSMUSE00000214460 Chr8:108461579..108461666 No primer for this exon
upstream ENSMUSE00000214461 Chr8:108461394..108461491 AAAAGCTGCGAGAAGATCCA Chr8:108461415..108461434 60.1 45
upstream ENSMUSE00000214457 Chr8:108461141..108461281 CTGAGATGACTACGCGGATG Chr8:108461233..108461252 59.42 55

*** Putative Vector Insertion (Chr 8: 108461140 - 108461492) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214463 Chr8:108460766..108460881 AGAGCTGAGGTCCGTTCAAA Chr8:108460795..108460814 59.99 50
downstream ENSMUSE00000214456 Chr8:108460596..108460654 GAACCGGTCTTCCAACAGTG Chr8:108460589..108460608 60.54 55
downstream ENSMUSE00000225660 Chr8:108459896..108460047 AGTGATCACACAGGCATCCA Chr8:108459930..108459949 60.12 50
downstream ENSMUSE00000413165 Chr8:108459642..108459805 GTTCCAGGAGCAAATCGGTA Chr8:108459754..108459773 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTCGGTTGTAATCGCCTTG Chr8:108461430..108461450 59.96 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAACGATTCGGTTGCGTGA Chr8:108461436..108461456 62.12 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031897