Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34050
Trapped Gene
Ctnna3 (ENSMUSG00000060843)
Vector Insertion
Chr 10: 64138665 - 64297325
Public Clones IST12841A1 (tigm) IST15067E1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000515728 (Chr10:64138513..64138664 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTCTGACTGCGCTTGATG Chr10:64138568..64138587 59.88 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000515728 (Chr10:64138513..64138664 +)
Downstram Exon
ENSMUSE00000476819 (Chr10:64297326..64297418 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTCTGACTGCGCTTGATG Chr10:64138568..64138587 59.88 55 TCTGAATGCTGGTGTGGCTA Chr10:64297401..64297420 60.41 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666234 Chr10:62892846..62892927 GTCGAGCGACCTCCTGATAG Chr10:62892908..62892927 59.97 60
upstream ENSMUSE00000666231 Chr10:62920258..62920412 TCCAAAAGCTGAACCCAAAG Chr10:62920364..62920383 60.22 45
upstream ENSMUSE00000666233 Chr10:62966780..62966883 GAAACGCCAATAACCCTGAA Chr10:62966794..62966813 59.94 45
upstream ENSMUSE00000503639 Chr10:62966785..62966883 GAAACGCCAATAACCCTGAA Chr10:62966794..62966813 59.94 45
upstream ENSMUSE00000505914 Chr10:63000269..63000461 CTTCTAGCTTCCGTGGAGGA Chr10:63000341..63000360 59.57 55
upstream ENSMUSE00000463264 Chr10:63029552..63029718 CTCCTTGTTCTTGCCGACAT Chr10:63029662..63029681 60.26 50
upstream ENSMUSE00000465036 Chr10:63044692..63044811 TTTCCAACAAGTCCGACCTC Chr10:63044723..63044742 60.09 50
upstream ENSMUSE00000464563 Chr10:63282970..63283233 GGAACATTCCGATGTTGCTT Chr10:63283068..63283087 59.94 45
upstream ENSMUSE00000475444 Chr10:63315370..63315573 CCTGCTGACGGAGTACATGA Chr10:63315549..63315568 59.85 55
upstream ENSMUSE00000461468 Chr10:63713446..63713526 GACAAGAGACCTCCGCAGAC Chr10:63713505..63713524 59.99 60
upstream ENSMUSE00000514746 Chr10:63723561..63723713 GCCGAGTCAAGGAAATCAAA Chr10:63723649..63723668 60.19 45
upstream ENSMUSE00000518886 Chr10:63871939..63872031 TCAGAATTGCAGCCAATCAC Chr10:63871991..63872010 59.81 45
upstream ENSMUSE00000517836 Chr10:63950210..63950366 CATCACCAGCATTGACGACT Chr10:63950332..63950351 59.71 50
upstream ENSMUSE00000467799 Chr10:64048708..64048908 CACCGAAGGTGTGATGAGAA Chr10:64048865..64048884 59.68 50
upstream ENSMUSE00000515728 Chr10:64138513..64138664 CTCTCTGACTGCGCTTGATG Chr10:64138568..64138587 59.88 55

*** Putative Vector Insertion (Chr 10: 64138665 - 64297325) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000476819 Chr10:64297326..64297418 TCTGAATGCTGGTGTGGCTA Chr10:64297401..64297420 60.41 50
downstream ENSMUSE00000479058 Chr10:64335909..64336090 CCAGCTTGCTCTTCACCTTC Chr10:64335996..64336015 60.13 55
downstream ENSMUSE00000478041 Chr10:64408667..64408772 AATCTGCCGAGCAAGAACAT Chr10:64408766..64408785 59.84 45
downstream ENSMUSE00000487262 Chr10:64422518..64422652 CCCCCAGATTTTGGATCTCT Chr10:64422635..64422654 60.26 50
downstream ENSMUSE00000489051 Chr10:64465294..64465690 GAACTCTGGATGCGGATGAT Chr10:64465409..64465428 60.04 50
downstream ENSMUSE00000666230 Chr10:64465294..64466415 GAACTCTGGATGCGGATGAT Chr10:64465409..64465428 60.04 50
downstream ENSMUSE00000666232 Chr10:64465294..64465713 GAACTCTGGATGCGGATGAT Chr10:64465409..64465428 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr10:64249715..64249735 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGTACGTGACTGGGAAAACC Chr10:64198711..64198732 59.88 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060843