Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34060
Trapped Gene
Tfdp2 (ENSMUSG00000032411)
Vector Insertion
Chr 9: 96211108 - 96217895
Public Clones IST11943G12 (tigm) IST14626D5 (tigm) IST10561F1 (tigm) IST14168G5 (tigm)
IST11653E1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000530942 (Chr9:96210941..96211107 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTTGAGATCCACGACGACA Chr9:96210971..96210990 59.83 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000530942 (Chr9:96210941..96211107 +)
Downstram Exon
ENSMUSE00000530941 (Chr9:96217896..96218001 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTTGAGATCCACGACGACA Chr9:96210971..96210990 59.83 50 CCAAGAAGGTCCTGTGGAGA Chr9:96217921..96217940 60.23 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634876 Chr9:96096767..96096979 GCCTTGACCCTTCCTGCACT Chr9:96096799..96096818 63.94 60
upstream ENSMUSE00000634875 Chr9:96102550..96102607 GCTGAAGAGAGAGCCCTGAT Chr9:96102581..96102600 58.72 55
upstream ENSMUSE00000693791 Chr9:96133101..96133167 GCAGAGCTGAGGGGCTTTAT Chr9:96133122..96133141 60.87 55
upstream ENSMUSE00000693790 Chr9:96147469..96147507 AAGTGGAATTGCTGGGTCAT Chr9:96147485..96147504 59.41 45
upstream ENSMUSE00000219556 Chr9:96174258..96174361 TTTCAAGCACCAACTCACCA Chr9:96174285..96174304 60.28 45
upstream ENSMUSE00000489999 Chr9:96188020..96188141 CGCAATGGTCACTCAGACTC Chr9:96188091..96188110 59.42 55
upstream ENSMUSE00000233223 Chr9:96190999..96191046 No primer for this exon
upstream ENSMUSE00000530945 Chr9:96195384..96195546 GAGAAAGTTCAGCGGAAAGG Chr9:96195448..96195467 59.05 50
upstream ENSMUSE00000693779 Chr9:96198043..96198189 GCCTACCAATTCTGCTCAGG Chr9:96198153..96198172 59.84 55
upstream ENSMUSE00000462451 Chr9:96198046..96198189 GCCTACCAATTCTGCTCAGG Chr9:96198153..96198172 59.84 55
upstream ENSMUSE00000530944 Chr9:96200791..96200859 GAGAAGCAGAGGCGGATAGA Chr9:96200794..96200813 59.68 55
upstream ENSMUSE00000530943 Chr9:96207219..96207370 TGTGAATTCCACCATTCAGC Chr9:96207287..96207306 59.5 45
upstream ENSMUSE00000530942 Chr9:96210941..96211107 CTTTGAGATCCACGACGACA Chr9:96210971..96210990 59.83 50

*** Putative Vector Insertion (Chr 9: 96211108 - 96217895) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000530941 Chr9:96217896..96218001 CCAAGAAGGTCCTGTGGAGA Chr9:96217921..96217940 60.23 55
downstream ENSMUSE00000459397 Chr9:96218207..96219400 CGTAAAAGCTTGCTCCGTTC Chr9:96218934..96218953 60.02 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATCCCTGGTTCCAAAAGC Chr9:96217069..96217089 60.3 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAATCCCTGGTTCCAAAAGC Chr9:96217069..96217089 60.3 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032411