Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34067
Trapped Gene
Kynu (ENSMUSG00000026866)
Vector Insertion
Chr 2: 43484572 - 43487065
Public Clones IST12615B6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 60% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000163686 (Chr2:43484473..43484571 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTAGCACATGCAGTTGGAA Chr2:43484493..43484512 59.86 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000163686 (Chr2:43484473..43484571 +)
Downstram Exon
ENSMUSE00000163674 (Chr2:43487066..43487139 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTAGCACATGCAGTTGGAA Chr2:43484493..43484512 59.86 50 TGAGCATGTTTCTCGTGGAC Chr2:43487127..43487146 59.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000274855 Chr2:43410849..43410929 TGGGGACAAAGAAAGATCCA Chr2:43410864..43410883 60.43 45
upstream ENSMUSE00000603169 Chr2:43410862..43410929 TGGGGACAAAGAAAGATCCA Chr2:43410864..43410883 60.43 45
upstream ENSMUSE00000274846 Chr2:43418477..43418658 TGAGCTTCCAGTTGATGCAG Chr2:43418507..43418526 60.14 50
upstream ENSMUSE00000714515 Chr2:43418477..43418658 TGAGCTTCCAGTTGATGCAG Chr2:43418507..43418526 60.14 50
upstream ENSMUSE00000274838 Chr2:43436866..43436986 AAATTCCCTTGGCCTTCAAC Chr2:43436915..43436934 60.3 45
upstream ENSMUSE00000274830 Chr2:43444909..43444991 CAAACGCCCTTGGATTGTAG Chr2:43444933..43444952 60.49 50
upstream ENSMUSE00000274819 Chr2:43455101..43455162 No primer for this exon
upstream ENSMUSE00000163675 Chr2:43456245..43456316 AAAGCGGCACAAAATTCTTC Chr2:43456268..43456287 59.34 40
upstream ENSMUSE00000163680 Chr2:43457763..43457837 GGATGGTAAAGCCACGAGAG Chr2:43457818..43457837 59.69 55
upstream ENSMUSE00000163689 Chr2:43459662..43459808 CAAAAGCTGGACATGCAAAG Chr2:43459789..43459808 59.46 45
upstream ENSMUSE00000163686 Chr2:43484473..43484571 CCTAGCACATGCAGTTGGAA Chr2:43484493..43484512 59.86 50

*** Putative Vector Insertion (Chr 2: 43484572 - 43487065) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000163674 Chr2:43487066..43487139 TGAGCATGTTTCTCGTGGAC Chr2:43487127..43487146 59.84 50
downstream ENSMUSE00000567279 Chr2:43490472..43490541 ATGCAAACAGGTTGCCTTTC Chr2:43490524..43490543 60.12 45
downstream ENSMUSE00000163684 Chr2:43526879..43526931 TACTGAGGTCATGGCCGAAC Chr2:43526913..43526932 61.07 55
downstream ENSMUSE00000163682 Chr2:43528191..43528276 CCCCGGGGATTAATTGTAGT Chr2:43528214..43528233 59.9 50
downstream ENSMUSE00000645484 Chr2:43533360..43533407 CATGTGGAGGGCAAAGTGTC Chr2:43533405..43533424 61.53 55
downstream ENSMUSE00000163676 Chr2:43535272..43535502 TTTTCTTCTCAGCGCAGTCA Chr2:43535313..43535332 59.86 45
downstream ENSMUSE00000693304 Chr2:43535272..43535736 TTTTCTTCTCAGCGCAGTCA Chr2:43535313..43535332 59.86 45
downstream ENSMUSE00000274770 Chr2:43536869..43538235 CATCTGGTTCTCGCTTGTCA Chr2:43536893..43536912 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000026866